Skip to main content
Egyptian Journal of Biological Pest Control
Download PDF

Management of bacterial wilt (Ralstonia solanacearum) of brinjal using Bacillus cereus, Trichoderma harzianum and Calotropis gigantea consortia in Bangladesh

Egyptian Journal of Biological Pest Control volume 33, Article number: 74 (2023) Cite this article

Abstract

Background

Bacterial wilt caused by Ralstonia solanacearum is a devastating disease of brinjal in Bangladesh. The study was targeted to evaluate the bacterial wilt management ability of microbial consortia composed of isolated and identified native Bacillus cereus, Trichoderma harzianum and Calotropis gigantea for the first time in Bangladesh.

Results

Twenty bacterial strains were isolated from the rhizosphere of the brinjal plant following serial dilution method. Among the strains, HSTUB 17 showed maximum zone of inhibition (1.5 ± 0.1 cm) against R. solanacearum in the dual culture method. Molecular characterization using 16 s rRNA partial coding sequence revealed HSTUB 17 as B. cereus. Consortia composed with the identified B. cereus HSTUB 17 (108 CFU ml−1 @ 5 ml/plant), previously isolated T. harzianum (@5 mm size of four mycelial disk/plant) and aqueous leaf extracts of C. gigantea (1:1, w/v basis @ 40 ml/plant) were applied in the root zone following soil drenching method and found to reduce bacterial wilt incidence by 74.87, 66.67 and 66.67% at 30, 50 and 70 days after transplanting, respectively, in comparison with plants received only R. solanacearum (108 CFU ml−1 @ 5 ml/plant). The single application of B. cereus HSTUB 17, T. harzianum and C. gigantea also minimized wilt incidence by 21.16–37.34, 33.33 and 21.48–28.14%, respectively, on all the days of observations. The consortia of B. cereus HSTUB 17, T. harzianum and C. gigantea also resulted in maximum plant height (56.67 cm), the number of branches/plants (10.33), the number of fruits/plants (8.33) and fruit yield (25.56 ton/ha) in comparison with the plant exposed to R. solanacearum only.

Conclusion

The findings of the study revealed the potentiality of consortia composed of B. cereus HSTUB 17, T. harzianum and C. gigantea for the eco-friendly management of bacterial wilt of brinjal for the first time in Bangladesh.

Background

Eggplant or brinjal (Solanum melongena L.) belongs to the family Solanaceae and is one of the important vegetable crops ranked second after potato in Bangladesh (BBS 2021). The annual production of brinjal (587 metric tons) in Bangladesh is far low in comparison with other brinjal-producing countries like India, China and Japan (BBS 2021). Various factors such as environmental and edaphic conditions, insect pests and diseases play significant role in the reduced yield of brinjal. About 12 diseases were reported associating with brinjal, which considered as the major concerning issue in Bangladesh for the lower production of brinjal. Among the diseases, bacterial wilt caused by Ralstonia solanacearum is the most destructive in the field conditions and reported to contribute about 10–90% yield loss in Bangladesh (Nishat et al. 2015). Ralstonia solanacearum infects the plant’s roots from transplanting to harvesting by colonizing the vascular system, blocking the translocation of water and nutrients (Sharma and Sharma 2014).

For the management of bacterial wilt, various tactics including crop rotation, use of resistant varieties, grafting with disease-free wild rootstock, soil fumigation, chemicals, etc. have been reported (Islam et al. 2014). Farmers of Bangladesh traditionally use chemicals as the least option for controlling such kinds of devastating diseases even prior to any suggestions from the experts. Hence, using chemicals is now becoming a mammoth threat to the environment, human health and the development of resistance to plant pathogens (Nishimoto 2019). Therefore, researchers around the world are trying to explore natural-based alternative ways of controlling wilt disease without chemicals.

Integration of naturally available plant disease management tools including beneficial microbes, such as Bacillus, Pseudomonas, Trichoderma, along with different medicinal plants has gained momentum for their cost-effectiveness, durability and environmental safety nature (Lahlali et al. 2022). The biocontrol agents, Trichoderma as well as Bacillus spp., have long been well proved for their efficacy in controlling numerous soilborne plant pathogens including R. solanacearum (Konappa et al. 2018). Moreover, Trichoderma and Bacillus also enhanced plant growth and yield in various crops (Islam et al. 2022). Again, Calotropis gigantea (akondo) also showed disease suppressing and plant growth ability, as it possessed various antimicrobial compounds like flavonoids, alkaloids, saponins and tannins (Shrivastava et al. 2013). However, the combination of various biocontrol agents as consortia demonstrated the superior crop disease management efficacy and enhanced crop growth in comparison with their single application (Jahagirdar et al. 2021). So far, limited or no work on the management of bacteria wilt of brinjal using the consortia of Bacillus, Trichoderma and Calotropis has been reported in Bangladesh. Therefore, the present study was designed to evaluate the efficacy of the consortia composed of B. cereus, T. harzianum and C. gigantea for the eco-friendly management of bacterial wilt of brinjal.

Methods

Isolation and identification of R. solanacearum

Ralstonia solanacearum, the causal agent of bacterial wilt of brinjal, was isolated from the wilted brinjal plant following Kelman (1954). In brief, wilted brinjal plants were brought to the laboratory, washed vigorously in running tap water, cut into small pieces and surface-sterilized using 0.1% HgCl2 for 1 min followed by three times washing with double-distilled sterilized water (ddsH2O). The cut pieces were then transferred into a beaker containing ddsH2O for 5 min to get milky, white bacterial exudates. Bacterial suspension from the beaker was then directly streaked on the Petri plates containing sterilized and solidified nutrient agar (NA) (meat extract, 10 g; peptone, 10 g; NaCl, 1.5 g; agar, 15 g; adjusted to 1000 ml) and incubated at 28 ± 2 °C for 2 days. Finally, the isolate was re-streaked on triphenyl tetrazolium chloride (TTC or TZC) medium to obtain the single colony. Naked eye observation was carried out for the morphological characters of the isolates.

Pathogenicity of the isolated R. solanacearum

Pathogenicity test of the isolated R. solanacearum was performed by inoculating it to healthy brinjal seedlings (BARI Hybrid Brinjal-4) following Gutarra et al. (2017). The roots of 2-week-old brinjal seedlings were damaged with a sterile scissor and inoculated with 4 ml of overnight cultured bacterial suspension (108 cfu/ml). A total of six seedlings was used for the pathogenicity test, where control was also maintained without the inoculation of bacterial suspension.

Isolation and purification of Bacillus spp.

Beneficial bacterial strains were isolated from the rhizosphere soil of brinjal plants (BARI Hybrid Brinjal-4) following serial dilution method (Prashanthi et al. 2021). In brief, 1 g soil was suspended in 9 ml ddsH2O and diluted up to 10−6. From the diluted suspension, a total of 100 μl was poured onto Petri plates containing NA medium and incubated at 28 ± 2 °C for 48 h. The developed single colony was further streaked onto a new NA containing Petri plates and preserved in a refrigerator at 4 °C for further use.

In vitro screening of the isolated Bacillus spp. against R. solanacearum

The antibacterial efficacy of the isolated Bacillus spp. against R. solanacearum was carried out on NA medium following the agar well diffusion method (Lemessa and Zeller 2007). In brief, a total of 100 µl of overnight cultured R. Solanacearum (108 cfu/ml) was spread on NA medium, followed by the making of three holes (9 mm) by using a sterile cork borer. Thirty µL beneficial bacterial suspensions (107 cfu/ml) of each strain was then, added to each hole and incubated at 28 ± 2 °C for 48 h. The growth inhibition R. solanacearum in response to the beneficial bacterial strains was measured as the radius of the inhibition zone (cm).

Morphological and biochemical characterization of Bacillus spp.

The beneficial bacterial strains (Bacillus spp.) that showed antibacterial efficacy against R. solanacearum were selected for morphological study. Twenty-four-h-old bacterial colonies were cultured on an NA medium and used to observe the colony color, shape, etc. using the naked eye and microscopic observation (Goodfellow et al. 2012).

Potassium hydroxide (KOH) test

A loopful of 3-day-old bacterial colony was mixed with two drops of 3% KOH solution on a glass slide and stirred for 10 s in a circular motion, and the formation of slime threads was observed by raising 1 cm from the surface using a toothpick (Suslow et al. 1982).

Catalase oxidase test

A single drop of 3% solution of hydrogen peroxide (H2O2) was mixed with a loopful of 3-day-old bacterial culture on a glass slide, and the production of gas bubbles was observed with the naked eye (Reiner 2010).

Starch hydrolysis test

Bacterial strains were cultured on NA medium containing 0.2% soluble starch (w/v) and incubated for 2 days at 28 ± 2 °C. After heavy growth of the strains, IKI solution (Iodine 1 g, potassium iodide 2 g, distilled water 100 ml) was added to the plates and examined development of a clear zone around the colony just after 30 s (Sands 1990).

Tobacco hypersensitivity test

The bacterial suspension (108 cfu/ml) in deionized water was injected into the intercellular space of the tobacco leaves with the help of a hypodermic syringe. Negative control was maintained by infiltrating the leaves with deionized water, and leaf interactions were noticed at 24 h after infiltration (Klement et al. 1990).

Potato soft rot test

Potato soft rot test for the strains was conducted by placing sterilized potato slices (7–8 mm thickness) in a sterilized Petri plate containing moistened and sterile filter paper (Whatman no. 1). Spore suspension of each bacterial strain was then, sprayed on the sliced potato and observed for 48 h for the development of rotting symptoms (Lelliott and Stead 1987). Only sterile water sprayed on potato slices was treated as a control.

Molecular characterization of the isolated Bacillus spp.

The bacterial strain, namely HSTUB 17, which showed the highest zone of inhibition against R. solanacearum, was selected for the molecular characterization using 16S rRNA partial coding sequence. Genomic DNA of HSTUB 17 was extracted by using a homogenizer (Pro Scientific) and an automated DNA extractor (model: Maxwell 16, Promega, USA), quantified with a NanoDrop spectrophotometer (model: ND2000, Thermo Scientific, USA) and kept at − 20 °C until further use. Tow universal primers, viz. 27 forward: 5′ AGAGTTTGATCMTGGCTCAG 3′ and 1492 Reverse: 5′ CGGTTACCTTGTTACGACTT 3′, were used to amplify the DNA. PCRs were carried out in a 20 µl reaction containing DNA template (1 µl of 25–65 ng/µl) mixed with 10 µl hot start green master mix (Buffer, dNTPs, MgCl2 and Taq polymerase; origin: Promega, USA), 1 µl of each primer (10–20 pMol) and PCR grade water. The reactions mixture was placed in a thermocycler (Gene Atlas, model: G2, origin: Astec, Japan) with an initial denaturation profile for 3 min at 95 °C, denaturation for 30 s at 95 °C, annealing for 30 s at 48 °C and extension for 90 s at 72 °C, followed by thirty-five cycles with final extension for 5 min at 72 °C. The PCR product was then, loaded on 1.0% agarose gel along with 1 Kb DNA ladder (Promega, USA; Horizontal, model: mini, origin: CBS Scientific, USA) and documented (Alpha Imager, model: Mini, origin: Protein Simple, USA). PCR products were then, purified using SV gel and PCR cleanup system (Promega, USA; Centrifuge, model: Kitman24, origin: Tomy, Japan) and sequenced following Sanger Sequencing by Apical Scientific-Malaysia.

Constructions of phylogenetic tree

The homology comparison of the 16S rRNA gene sequence of HSTUB 17 was retrieved by running the sequenced data through the BLASTN on the NCBI database (http://www.ncbi.nlm.nih.gov/Blast.cgi). The phylogenetic tree was constructed using the MEGA 11 software package following the neighbor-joining method (Saitou and Nei 1987; Tamura et al. 2021).

Collection of T. harzianum

Trichoderma harzianum was collected from the Department of Plant Pathology, HSTU, which was previously isolated and identified. The antagonist was subcultured and kept in a refrigerator at 4 °C until further use.

Collection and preparation of leaf extracts of C. gigantea

Aqueous extracts of C. gigantea were prepared by using fresh leaves (Ul-Haq et al. 2014). In brief, collected fresh leaves were washed in running tap water and air-dried in the shed. Totally, 100 g dried leaves was dipped in 100 ml ddsH2O (1:1, w/v basis), blended using an electric blender, filtered using a double-layered fine muslin cloth and kept in a refrigerator at 4 °C until further use.

Management of bacterial wilt of brinjal using the identified B. cereus HSTUB 17, T. harzianum and C. gigantea

A field study was carried out at the central research field, HSTU, Dinajpur, Bangladesh (25° 13′ N latitude and 88° 23′ E longitudes), during the Rabi season (Nov.-March) of 2019–2020. Brinjal seeds (BARI Hybrid Brinjal-4) were collected from Bangladesh Agricultural Research Institute (BARI), Joydebpur, Gazipur, surface sterilized with 10% sodium hypochlorite (NaOCl) solution for 2 min, washed with ddsH2O for 3 times and air-dried. Fifty seeds were sown in each of the earthen pots (22 × 14 × 6 cm3) containing sterilized soil and well-decomposed cow dung (1:2). Twenty-five-day-old seedlings were transplanted to the field (@4 plants/plot) with an individual plot size of 1.5 m × 1.0 m, plot to plot distance of 50 cm. Nine treatment combinations, viz. control (without R. solanacearum or any bio-agents) (Ctrl); negative control (only R. solanacearum) (NCtrl); R. solanacearum and B. cereus HSTUB 17 (Bc); R. solanacearum and T. harzianum (Th); R. solanacearum and C. gigantea (Cg); R. solanacearum, B. cereus HSTUB 17 (Bc) and C. gigantea (Cg); R. solanacearum, B. cereus HSTUB 17 (Bc) and T. harzianum (Th); R. solanacearum, B. cereus HSTUB 17 (Bc), T. harzianum (Th) and C. gigantea (Cg); and R. solanacearum and streptocycline (Strp). All the treatments were replicated thrice, following Randomized Complete Block Design (RCBD). The bio-agents were applied, 7 days after transplantation (DAT) as follows: both B. cereus and R. solanacearum (108 cfu/ml) @ 5 ml/plant; four mycelial disk (5 mm dia.) of T. harzianum at the root zone of each plant; spraying of streptocycline @ 0.5 g/l of water; C. gigantea leaf extract @ 40 ml/plant. The intercultural operations were maintained throughout the growing season as and when necessary. Bacterial wilt incidence (%) was recorded at 30, 50 and 70 DAT (Song et al. 2004):

$${\text{Percentage of disease incidence}}\;\left( {{\text{PDI}}} \right) = \frac{{\text{Number of wilted plants per plot}}}{{\text{Total number of plants per plot}}} \times 100$$

Plant height (cm), the number of branches/plants and the number of leaves/plants were also recorded at 30, 50 and 70 DAT. The number of fruits/plants was recorded at 70 and 90 DAT, and yield (ton/ha) was estimated from each of the plots.

Statistical analysis

Data collected on wilt incidence and agronomic attributes were analyzed using the statistical package “R” (version 4.1.2.). The means of all the treatments were computed by DMRT (Duncan multiple range test) at 5% level of probability (Gomez and Gomez 1984).

Results

Identification of R. solanacearum

The purified colonies of R. solanacearum on TTC medium showed the light red or pink color with a characteristic red center and whitish margin. The isolated R. solanacearum produced characteristics wilt symptoms in the inoculated brinjal plant.

Screening of Bacillus sp. against R. solanacearum

A total of 20 bacterial strains were isolated from the rhizosphere of brinjal plants. Among the isolated strains, four strains, namely HSTUB 12, HSTUB 14, HSTUB 17 and HSTUB 18, showed antibacterial efficacy against R. solanacearum (Fig. 1). However, HSTUB 17 gave the highest zone of inhibition (1.5 ± 0.1 cm), followed by HSTUB 14 (1.0 ± 0.2), HSTUB 12 (0.9 ± 0.1) and HSTUB 18 (0.7 ± 0.2) (Table 1).

Fig. 1
figure 1

In vitro screening of Bacillus spp. against Ralstonia solanacearum; A HSTUB 14; B HSTUB 17; C HSTUB 18; D HSTUB 12

Full size image
Table 1 Morphological and biochemical characterization of the isolated bacterial strains (Bacillus spp.)
Full size table

Identification of Bacillus sp.

All the four strains, namely HSTUB 12, HSTUB 14, HSTUB 17 and HSTUB 18, were found to produce creamy yellowish or whitish color colonies, flat or somewhat convex with rough edges on NA medium. Again, all the strains also showed positive reactions to catalase oxidase and tobacco hypersensitivity tests, and negative responses to KOH, starch hydrolysis and soft rot tests (Fig. 2; Table 1). Further, totally 1500-bp PCR-amplified DNA was obtained from HSTUB 17 which showed maximum similarity and close relationship with B. cereus strain K1M36 (accession no. MW559327) and B. cereus strain K1M20 (accession no. MW559293) by both BLASTN search and phylogenetic tree analysis (Fig. 3).

Fig. 2
figure 2

Biochemical characterization of Bacillus spp. A Potassium hydroxide (KOH) test; B tobacco hypersensitivity test; C catalase oxidase test; D starch hydrolysis test; E potato soft rot test

Full size image
Fig. 3
figure 3

A Gel electrophoresis of the amplified DNA obtained from Bacillus cereus HSTUB 17. M; marker; B phylogenetic tree of B. cereus HSTUB 17 using 16S rRNA, showing names of related bacterial species

Full size image

Efficacy of the consortia composed of B. cereus HSTUB 17, T. harzianum and C. gigantea against bacterial wilt

In comparison with plants inoculated with R. solanacearum only, the consortia composed of B. cereus HSTUB 17, T. harzianum and C. gigantea resulted maximum reduction of bacterial wilt incidence (74.87, 66.67 and 66.67%), followed by consortia of B. cereus HSTUB 17 and C. gigantea (49.37, 55.56 and 43.70%); consortia of B. cereus HSTUB 17 and T. harzianum (49.37, 44.90 and 44.90%) at 30, 50 and 70 DAT, respectively (Table 2). Plants that received no bio-agents or only B. cereus HSTUB 17 or T. harzianum or C. gigantea also reduced wilt incidence by 13.07–37.34, 22.22–33.33 and 11.11–28.14%, respectively, in comparison with plants inoculated with R. solanacearum only (Table 2).

Table 2 Efficacy of consortia of Bacillus cereus HSTUB 17, Trichoderma harzianum and Calotropis gigantea on wilt incidence (%) of brinjal at different days of observations
Full size table

Along with the suppression of wilt disease, the consortia of B. cereus HSTUB 17, T. harzianum and C. gigantea significantly increased plant height (28.93–56.67 cm) and the number of branches/plants (6.08–10.33) at all date of observations in comparison with the R. solanacearum inoculated plant (27.60–49.67 cm and 4.75–6.50). At 70 and 90 DAT, the highest number of fruits/plants (6.58 and 8.67) was also recorded in response to the application of the consortia composed of B. cereus HSTUB 17, T. harzianum and C. gigantean. Likewise, the number of fruits and maximum yield (25.56 ton/ha) were also obtained with the consortia composed of B. cereus HSTUB 17, T. harzianum and C. gigantean, followed by the consortia of B. cereus HSTUB 17 and T. harzianum (17.78 ton/ha); and consortia of B. cereus HSTUB 17 and C. gigantea (16.67 ton/ha) (Table 3).

Table 3 Efficacy of consortia of Bacillus cereus HSTUB 17, Trichoderma harzianum and Calotropis gigantea on different agronomic traits of brinjal at different days of observations
Full size table

Discussion

The isolated and purified R. solanacearum produced characteristics light red or pink colony on TTC or TZC (Kelman 1954), which after inoculation produced wilt symptoms in brinjal plants (Akter et al. 2021). After getting entrance to the plant, R. solanacearum colonizes in the xylem vessel which eventually blocks the translocation of water from the root to the upper parts of the plant and cause wilt symptoms (Ingel et al. 2022). For the controlling of wilt diseases, 20 rhizosphere bacteria were isolated and screened them against R. solanacearum under in vitro. Among the isolates, B. cereus HSTUB 17 suppressed the growth of R. solanacearum with a maximum zone of inhibition. Beneficial bacteria, viz. Bacillus, Pseudomonas, etc., possess several antimicrobial secondary metabolites including volatile compounds, enzymes and siderophores which are responsible for the broad-spectrum antibacterial efficacy against various fungal and bacterial pathogens (Iqbal et al. 2021). However, the potential strains obtained in this study were assumed as Bacillus spp., as they produced characteristics of creamy yellowish or whitish color colonies with rough edges (Al-Saraireh et al. 2015). The potential strains also showed positive reactions in catalase oxidase test by producing gas bubbles and hypersensitive response in tobacco hypersensitivity test and hence were considered as Bacillus spp. (Goodfellow et al. 2012). More than 90% similarity of around 1500-bp gene sequence of B. cereus HSTUB 17 with the deposited partial gene sequence of B. cereus in NCBI and its phylogenetic tree analysis confirm the isolate as B. cereus (Moussa et al. 2022).

The isolated B. cereus HSTUB 17 along with T. harzianum and C. gigantea either alone or in various combinations demonstrated remarkable suppression of bacterial wilt disease of brinjal in field conditions in the present study. The bio-agents as consortia not only reduced the disease, but also enhanced different agronomic traits of the brinjal plant including yield. Bacillus spp. and Trichoderma spp. have long proved their efficacy in controlling various plant diseases caused by a wide range of plant pathogens including R. solanacearum (Zhou et al. 2021). Besides, the use of plant extracts including C. gigantea leaf extracts was reported to show antimicrobial effects, when applied against numerous plant diseases (Abo-Elyousr et al. 2022). In contrast to the single application, the consortia of bio-agents showed maximum suppression of wilt diseases along with enhanced agronomic attributes. The consortia of beneficial bacteria including Bacillus, Pseudomonas, etc. with Trichoderma have been found to suppress diversified diseases in contrast to their single use (Chaudhary et al. 2023). Again, the combination of two Bacillus strains showed elicited activities of superoxide dismutase and peroxidases during the management of soilborne diseases of tomato and pepper in comparison with their single application (Jetiyanon 2007). The secretion or presence of various inhibitory metabolites such as indole-3-acetic acid, β-1-3-glucanase, siderophores and gibberellins in Trichoderma; 2,3-butanediol, cellulose, acetoin, antibiotics and lipopeptides in Bacillus; and flavonoids, phenols, polysaccharide terpenes and saponins in C. gigantean might be responsible for triggering plant growth and yield with reduced plant disease (Albayrak 2019). Trichoderma and Rhizobium consortia already demonstrated enhanced uptake of nitrogen and phosphorous during the management of soilborne diseases in chickpeas (Rudresh et al. 2005). Moreover, compatible microbes in consortia may show better performance than the single use due to the exposure of several additives or synergistic tactics with numerous modes of action, viz. competition, mycoparasitism, induced systemic resistance, etc. (Sarma et al. 2015).

Conclusion

The rhizosphere of crop plants is the harbor of microbial antagonists that assist plants with systematic resistance along with enhanced growth and yield. The present study explored the ability of consortia composed with a native Bacillus cereus, T. harzianum and C. gigantea for the management of bacterial wilt of brinjal in field conditions. Compared to the single use, consortia of the selected bio-agents resulted in maximum reduction of wilt incidence (%). The consortia not only reduced the disease, but it also enhanced plant height, the number of branches and yield of the brinjal plant. However, the findings of the study explore the probability of the use of B. cereus HSTUB 17, T. harzianum and C. gigantea as consortia for the successful management of wilt of brinjal in Bangladesh. In addition, the consortia might also facilitate the absorption of various nutrients by the plant which has a direct effect on the minimization of chemical fertilizers. In the future, the persistence of the bio-agent in soil needs to be assessed for their better performance as consortia.

Availability of data and materials

All datasets on which conclusions of the study have been drawn are presented in the main manuscript.

Abbreviations

CFU:

Colony-forming unit

NA:

Nutrient agar

ddsH2O:

Double-distilled sterilized water

TTC:

Triphenyl tetrazolium chloride

RCBD:

Randomized complete block design

DAT:

Days after transplantation

PDI:

Percentage of disease incidence

DMRT:

Duncan multiple range test

References

  • Abo-Elyousr KAM, Ali EF, Sallam NMA (2022) Alternative control of tomato wilt using the aqueous extract of Calotropis procera. Horticulturae 8:197. https://doi.org/10.3390/horticulturae8030197

    Article  Google Scholar 

  • Akter N, Islam MR, Hossain MB, Islam MN, Chowdhury SR, Hoque S, Nitol RH, Tasnin R (2021) Management of wilt complex of eggplant (Solanum melongena L.) caused by Fusarium oxysporum, Ralstonia solanacearum and Meloidogyne spp. Am J Plant Sci 12:1155–1171. https://doi.org/10.4236/ajps.2021.127080

    Article  CAS  Google Scholar 

  • Albayrak ÇB (2019) Bacillus species as biocontrol agents for fungal plant pathogens. In: Islam M, Rahman M, Pandey P, Boehme M, Haesaert G (eds) Bacilli and agrobiotechnology: phytostimulation and biocontrol. Bacilli in climate resilient agriculture and bioprospecting. Springer, Cham. https://doi.org/10.1007/978-3-030-15175-1_13

    Chapter  Google Scholar 

  • Al-Saraireh H, Al-Zereini WA, Tarawneh KA (2015) Antimicrobial activity of secondary metabolites from a soil BaciIllus sp. 7B1 isolated from South Al-Karak, Jordan. Jordan J Biol Sci 8(2):127–132

    Article  CAS  Google Scholar 

  • BBS (2021) Year book of agricultural statistics of Bangladesh. Statistics Division, Bangladesh Bureau of Statistics, Ministry of Planning, Government of the Peoples’ Republic of Bangladesh, Dhaka

    Google Scholar 

  • Chaudhary P, Xu M, Ahamad L, Chaudhary A, Kumar G, Adeleke BS, Verma KK, Hu D-M, Širić I, Kumar P, Popescu SM, AbouFayssal S (2023) Application of synthetic consortia for improvement of soil fertility, pollution remediation, and agricultural productivity: a review. Agronomy 13(3):643. https://doi.org/10.3390/agronomy13030643

    Article  CAS  Google Scholar 

  • Gomez KA, Gomez AA (1984) Duncan’s multiple range test, statistical procedure for agricultural research, 2nd edn. Wiley Inter-Science Publication, New York, pp 202–215

    Google Scholar 

  • Goodfellow M, Kampfer P, Dusse HJ, Trujillo ME, Suzuki KI, Ludwig W, Whitman WB (2012) Bergey’s manual of systematic bacteriology, 2nd edn. Springer, New York

    Book  Google Scholar 

  • Gutarra L, Herrera J, Fernandez E, Kreuze J, Lindqvist-Kreuze H (2017) Diversity, pathogenicity, and current occurrence of bacterial wilt bacterium Ralstonia solanacearum in Peru. Front Plant Sci 8:1221. https://doi.org/10.3389/fpls.2017.01221

    Article  PubMed  PubMed Central  Google Scholar 

  • Ingel B, Caldwell D, Duong F, Parkinson DY, McCulloh KA, Iyer-Pascuzzi AS, McElrone AJ, Lowe-Power TM (2022) Revisiting the source of wilt symptoms: X-ray microcomputed tomography provides direct evidence that Ralstonia biomass clogs xylem vessels. PhytoFront 2:41–51

    Article  Google Scholar 

  • Iqbal S, Ullah N, Janjua HA (2021) In vitro evaluation and genome mining of Bacillus subtilis strain RS10 reveals its biocontrol and plant growth-promoting potential. Agriculture 11(12):1273. https://doi.org/10.3390/agriculture11121273

    Article  CAS  Google Scholar 

  • Islam MR, Mondal C, Hossain I, Meah MB (2014) Compost tea as soil drench: an alternative approach to control bacterial wilt in brinjal. Arch Phytopathol Plant Prot 47:1475–1488

    Article  Google Scholar 

  • Islam MM, Islam ATMS, Hasan MM, Rashid MM, Hossain SMM (2022) Potentiality of native Trichoderma harzianum in controlling damping off and foot rot of chilli and its viability in different storage conditions. Pak J Agric Sci 59:29–34

    Google Scholar 

  • Jahagirdar S, Hegde G, Krishnaraj PU, Kambrekar DN (2021) Microbial consortia for plant disease management and sustainable productivity. In: Singh KP, Jahagirdar S, Sarma BK (eds) Emerging trends in plant pathology. Springer, Singapore. https://doi.org/10.1007/978-981-15-6275-4_17

    Chapter  Google Scholar 

  • Jetiyanon K (2007) Defensive-related enzyme response in plants treated with a mixture of Bacillus strains (IN937a and IN937b) against different pathogens. Biol Control 42:178–185

    Article  Google Scholar 

  • Kelman A (1954) The relationship of pathogenicity of Pseudomonas solanacearum to colony appearance on a tetrazolium medium. Phytopathology 44:639–695

    Google Scholar 

  • Klement Z, Rudolph K, Sands DC (1990) Methods in Phytobacteriology. Akademiai, Kiado, Budapest, p 568

    Google Scholar 

  • Konappa N, Krishnamurthy S, Siddaiah CN, Ramachandrappa NS, Chowdappa S (2018) Evaluation of biological efficacy of Trichoderma asperellum against tomato bacterial wilt caused by Ralstonia solanacearum. Egypt J Biol Pest Control 28:63

    Article  Google Scholar 

  • Lahlali R, El Hamss H, Mediouni-Ben Jemâa J, Barka EA (2022) Editorial: the use of plant extracts and essential oils as biopesticides. Front Agron 4:921–965. https://doi.org/10.3389/fagro.2022.921-965

    Article  Google Scholar 

  • Lelliott RA, Stead DE (1987) Methods for the diagnosis of bacterial diseases of plants. In: Preece TF (ed) Methods in plant pathology, vol 2. British society of plant pathology. Blackwell, Oxford, p 216

    Google Scholar 

  • Lemessa F, Zeller W (2007) Screening rhizobacteria for biological control of Ralstonia solanacearum in Ethiopia. Biol Control 42(3):336–344. https://doi.org/10.1016/j.biocontrol.2007.05.014

    Article  Google Scholar 

  • Moussa Z, Rashad EM, Elsherbiny EA, Al-Askar AA, Arishi AA, Al-Otibi FO, Saber WIA (2022) New strategy for inducing resistance against bacterial wilt disease using an avirulent strain of Ralstonia solanacearum. Microorganisms 10:1814. https://doi.org/10.3390/microorganisms10091814

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  • Nishat S, Hamim I, Khalil MI, Ali MA, Hossain MA, Meah MB, Islam MR (2015) Genetic diversity of the bacterial wilt pathogen Ralstonia solanacearum using a RAPD marker. C R Biol 338:757–767. https://doi.org/10.1016/j.crvi.2015.06.009

    Article  PubMed  Google Scholar 

  • Nishimoto R (2019) Global trends in the crop protection industry. J Pestic Sci 44:141–147. https://doi.org/10.1584/jpestics.D19-101

    Article  PubMed  PubMed Central  Google Scholar 

  • Prashanthi R, Shreevatsa GK, Krupalini S, Manoj L (2021) Isolation, characterization, and molecular identification of soil bacteria showing antibacterial activity against human pathogenic bacteria. J Genet Eng Biotechnol 19:120. https://doi.org/10.1186/s43141-021-00219-x

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  • Reiner K (2010) Catalse test protocol. American Society for Microbiology, ASM Microbe Library, Atlanta

    Google Scholar 

  • Rudresh DL, Shivaprakash MK, Prasad RD (2005) Effect of combined application of Rhizobium, phosphate solubilizing bacterium and Trichoderma spp. on growth, nutrient uptake and yield of chickpea (Cicer aritenium L.). Appl Soil Ecol 28:139–146

    Article  Google Scholar 

  • Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425

    CAS  PubMed  Google Scholar 

  • Sands DC (1990) Physiological criteria-determinative test. In: Klement Z, Rudolph K, Sands DC (eds) Methods in phytobacteriology. Akademiai Kiado, Budapest, pp 134–143

    Google Scholar 

  • Sarma BK, Yadav SK, Singh S, Singh HB (2015) Microbial consortium-mediated plant defense against phytopathogens: readdressing for enhancing efficacy. Soil Biol Biochem 87:25–33

    Article  CAS  Google Scholar 

  • Sharma N, Sharma DK (2014) Incidence and seed transmission of R. solanacearum (Smith) in brinjal (Solanum melongena L.) seeds. Int J Plant Pathol 5:63–69

    Article  Google Scholar 

  • Shrivastava A, Singh S, Singh S (2013) Phytochemical investigation of different plant parts of Calotropis procera. Int J Sci Res Publ 3(3):1–4

    Google Scholar 

  • Song W, Zhou L, Yang C, Cao X, Zhang L, Liu X (2004) Tomato Fusarium wilt and its chemical control strategies in a hydroponic system. Crop Prot 23:24

    Article  Google Scholar 

  • Suslow TV, Schroth MN, Isaka M (1982) Application of a rapid method for gram differentiation of plant pathogenic and saprophytic bacteria without staining. Phytopathology 72:917–918

    Article  Google Scholar 

  • Tamura K, Stecher G, Kumar S (2021) MEGA11: molecular evolutionary genetics analysis version 11. Mol Biol Evol 38:3022–3027. https://doi.org/10.1093/molbev/msab120

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  • Ul-Haq S, Hasan SS, Dhar A, Mital V, Sahaf KA (2014) Antifungal properties of phytoextracts of certain medicinal plants against leaf spot of disease of Mulberry, Morus spp. Plant Pathol Microbiol 5(2):224. https://doi.org/10.4172/2157-7471.1000224

    Article  Google Scholar 

  • Zhou Y, Yang L, Wang J, Guo L, Huang J (2021) Synergistic effect between Trichoderma virens and Bacillus velezensis on the control of tomato bacterial wilt disease. Horticulturae 7:439. https://doi.org/10.3390/horticulturae7110439

    Article  Google Scholar 

Download references

Acknowledgements

We appreciate Ministry of Science and Technology, Government of People’s Republic of Bangladesh and Institute of Research and Training (2020–2021), Hajee Mohammad Danesh Science and Technology University, Dinajpur-5200, Bangladesh, for the funding of the research.

Funding

This work was financially supported by Ministry of Science and Technology (2019–2020), Government of People’s Republic of Bangladesh and Institute of Research and Training (2020–2021), Hajee Mohammad Danesh Science and Technology University, Dinajpur-5200, Bangladesh.

Author information

Authors and Affiliations

  1. Department of Plant Pathology, Hajee Mohammad Danesh Science and Technology University (HSTU), Dinajpur, 5200, Bangladesh

    Most. Ummey Qulsum, Md. Mukul Islam, Sheikh Md. Mobarak Hossain & Md. Mohidul Hasan

  2. Training and Communication Wing, Bangladesh Agricultural Research Institute (BARI), Joydebpur, Gazipur, Bangladesh

    Md. Emran Khan Chowdhury

Authors
  1. Most. Ummey Qulsum
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Md. Mukul Islam
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Md. Emran Khan Chowdhury
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Sheikh Md. Mobarak Hossain
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Md. Mohidul Hasan
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

MUQ conducted the experiment, collected and analyzed the data, and drafted the manuscript. MMI wrote the manuscript. SkMMH analyzed the data. MEKC reviewed the manuscript. MMH designed the experiment, reviewed and edited the manuscript.

Corresponding authors

Correspondence to Md. Mukul Islam or Md. Mohidul Hasan.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Qulsum, M.U., Islam, M.M., Chowdhury, M.E.K. et al. Management of bacterial wilt (Ralstonia solanacearum) of brinjal using Bacillus cereus, Trichoderma harzianum and Calotropis gigantea consortia in Bangladesh. Egypt J Biol Pest Control 33, 74 (2023). https://doi.org/10.1186/s41938-023-00720-0

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s41938-023-00720-0

Keywords