Isolation and characterization of endophytic yeasts and green mold
Samples of healthy and infected lemon fruits that showed typical symptoms of the green mold disease were collected from a storage house located in Jeddah, Saudi Arabia, and seven isolates of endophytic yeasts and P. digitatum were obtained. Green mold pathogens were morphologically identified based on mycelial growth, colony color, and spore structure as described by Kurtzman et al. (2000), with identities confirmed by ITS region sequencing.
In vitro inhibition of P. digitatum by yeast
The in vitro inhibition of P. digitatum by seven yeast isolates was tested. A loop containing 24-h-old yeast was horizontally streaked near the edges of PDA; dextrose, 20 g; agar, 15 g; potato, 200 g) plates. A 5-mm mycelial plug of a 3-day-old P. digitatum colony grown on PDA was placed upside down on each streaked plates 3 cm from each streak. PDA plates containing only P. digitatum plugs were used as controls. Plates were incubated at 25 °C for 5 days, and the reduction in P. digitatum growth was calculated using the following formula:
$$ \mathrm{I}\%=\left(\mathrm{A}-\mathrm{B}/\mathrm{A}\right)\times 100 $$
Where I% is the percent mycelial growth inhibition, A represents the growth diameter of the control, and B represents the growth diameter (cm) of the pathogen for each treatments. Each experiment was performed twice with four replicates per experiment. The yeast isolates that most significantly reduced P. digitatum mycelial growth were selected for additional experiments.
Preparation of EEP
EEP were prepared by grinding 200 g of frozen propolis that was placed for 3 h prior to grinding. For grinding, 69% ethanol was used with an extraction ratio of 3:1 ethanol/propolis, and mixtures were shaken for 2 days at 150 rpm. Extracts were centrifuged at 5000 rpm for 10 min and filtered using filter paper. The resulting supernatant was collected and kept at room temperature for 3days to allow for evaporation, and the remaining resin was collected for future use. To prepare 1, 2, and 3% EEP solutions, equivalent weights of propolis were dissolved in the required volume of 70% ethanol. Then, EEP solutions were incubated in the refrigerator for further use Abdel-Rahim and Abo-Elyousr (2017).
In vitro inhibitory activity of EEP
To evaluate the in vitro inhibitory activity of EEP, conidia were collected from 1-week-old P. digitatum cultures grown on PDA plates incubated at 25 °C. Briefly, spore suspensions were prepared by addling distilled water to growing colony plates to collect spores, the concentration of each spore suspension was adjusted to 104 spore/mL, and 1 mL spore suspension was spread on the surface of a fresh PDA plate. Next, 0.5-cm-diameter wells were prepared in each plate in which 50 μL of 1%, 2%, or 3% EEP were poured, with 100 μL SDW plus 3% ethanol poured into wells of the control plates. Plates were then incubated at 25 °C for 5 days in the dark, and the inhibition zone (cm) around each well was measured. Four replicates for each treatment were used, and the experiment was conducted twice.
Molecular identification of bioagents
The selected bioagents were identified by PCR analysis of their ITS regions, except for P. digitatum, was identified based on morphology. For PCR amplification, DNA was extracted from 24-h-old yeast cultures using a DNeasy plant extraction kit (Qiagen, CA, USA) according to the manufacturer’s instructions. The primer pair ITS1 F (GCATCGATGAAGAACGCAGC) and ITS4 R (TCC TCC GCT TAT TGA TATGC) was used to amplify partial ITS gene sequences (White et al. 1990). Standard PCR was performed with reaction mixtures containing 20 μL DNA template, 4 μL 10 mM dNTPs, 5 μL 5× PCR buffer, 2.5 mM MgCl2, 2.5 U Taq polymerase (Promega), 25 pmol of each primer, and sterilized distilled water up to a final volume of 50 μL. Reactions were performed in a thermal cycler using the following conditions: initial denaturation at 94 °C for 3 min, followed by 35 cycles consisting of 94 °C for 60 s, 55 °C for 60 s, and 72 °C for 60 s, followed by a final extension of 72 °C for 7 min. PCR products (10 μL aliquots) were then analyzed on 1% agarose gels run for 75 min in TAE buffer (Tris, 40 mM; sodium acetate, 20 mM; EDTA, 1 mM; pH 7.2), with bands detected using a UV illuminator. Ribosomal ITS PCR products were identified based on their relative amounts of electrophoretic migration, then eluted from the gel, and purified using a purification kit (SolGent, Daejeon, South Korea), following the manufacturer’s instructions. PCR products were confirmed by sequencing (SolGent). Partial sequences of PCR products were compared with the whole yeast genome sequence obtained from NCBI, and the isolated sequences were 100% identical to the sequence obtained from NCBI.
In vitro effects of S. vanrijiae PHYTSV1 and EEP
In vitro inhibitory activity
To examine the in vitro inhibition of P. digitatum by EEP and S. vanrijiae, spore suspensions of P. digitatum were prepared from 3-day-old colonies by adding 5 mL distilled water to Petri plates containing 104 spores/mL. The resulting spore suspension (200μL) was then spread over the surface of a PDA plate. After the suspension had been absorbed by the plate, 0.5-cm punches were made into the agar and then filled with a 50-μL mixture of S. vanrijiae PHYTSV1 (1 × 109 CFU mL−1) and 3% EEP (1:1). Next, plates were incubated at 27 °C for 5 days, and the reduction in mycelial growth (I%) was calculated. Four replicates were used per experiment, and each experiment was conducted twice.
Effects on spore germination
Effects of EEP and S. vanrijiae PHYTSV1 on spore germination were determined. Glass tubes were filled by potato dextrose broth (PDB), and 100 μL P. digitatum conidial suspension (1 × 106 conidia/mL) was transferred to tubes containing S. vanrijiae PHYTSV1, EEP, or both. Control treatment tubes were also prepared with only PDB. Tubes were then incubated at 25 °C on a rotary shaker at 100 rpm for 15 h. To observe the germination rate for each treatment, at least 200 spores per replicate were examined under a microscope, and spore germination was determined using the criteria described by Elsherbiny et al. (2021). Germination inhibition of spores was calculated using the equation presented above. Three replicates were performed for each condition, and the experiment was conducted twice.
In vivo activity of S. vanrijiae PHYTSV1 and EEP
Preparation of pathogen and antagonist inoculum
To prepare the inoculum, P. digitatum was transferred onto PDA plates and incubated at 25 °C for 7 days. After germination, 10 mL distilled water was added to each plate, and spores were scraped into solution using a sterilized bacterial rod. The spore suspension was then filtered through a layer of sterile muslin cloth. Using a hemocytometer, the concentration of the conidial suspension was counted and adjusted to 24 × 106 CFU/mL (Abdel-Rahim and Abo-Elyousr 2018). Erlenmeyer flasks were filled with 50 mL yeast malt broth medium, inoculated with S. vanrijiae PHYTSV1, and then incubated at 25 °C with shaking at 200×g for 48 h. Tubes containing the resulting broth culture were then centrifuged at 6000 rpm for 10 min. The density of the re-suspended cells was then adjusted to 2 × 107 cells/mL using a hemocytometer.
Effects of S. vanrijiae and EEP on stored lemons
Effects of S. vanrijiae PHYTSV1 and EEP on lemon fruits (Citrus limon L. Burm) were examined using protocols described by Sallam et al. (2012) with minor modifications. Briefly, healthy lemons of the seedless lime variety were purchased, and the surface was sterilized by dipping the fruits in 2% NaClO for 2 min. After surface sterilization, fruits were rinsed 3 times with sterilized distilled water and then placed on sterile filter paper to dry. Next, 2-mm-deep and 5-mm-wide wounds were made on the surface of the peel of each fruit in opposing directions. Each wound was covered with 50 μL of S. vanrijiae (1 × 109 CFU/mL), 3% EEP, or a 1:1 v/v mixture of each. For control samples, 20 μL of sterile distilled water was added to each wound. Fruits were then allowed to sit at for 1 h, and then, 20 μL P. digitatum conidial suspension (104 CFU/mL) was injected into each fruit. The fruits were then incubated at 25 °C and 90% humidity for 7 days in (25 × 30 cm) plastic boxes. The resulting lesion diameter on each fruit was measured according to Madbouly et al. (2020), and the disease incidence and severity determined as follows:
$$ \%\mathrm{Disease}\ \mathrm{incidence}=\left(\mathrm{No}.\mathrm{of}\ \mathrm{infected}\ \mathrm{lemons}/\mathrm{Total}\ \mathrm{no}.\mathrm{of}\ \mathrm{lemons}\right)\times 100 $$
Disease severity was evaluated using the following rating scale: 0 = no infection observed; 1 = a quarter of the fruit decayed; 2 = half the fruit decayed; 3 = three-quarters of the fruit decayed; and 4 = the entire fruit decayed.
$$ \%\mathrm{Disease}\ \mathrm{severity}=100\times \Sigma\ \left(\mathrm{No}.\mathrm{of}\ \mathrm{infected}\ \mathrm{lemons}\times \mathrm{No}.\mathrm{scale}\right)/\mathrm{Total}\ \mathrm{no}.\mathrm{of}\ \mathrm{lemons}\times \mathrm{highness}\ \mathrm{no}.\mathrm{scale} $$
Four replicates were used to perform each treatment with 20 lemons per treatment.
Effects of yeast and propolis on peroxidase (POD) and polyphenol oxidase (PPO) activities in lemon tissues
Enzyme extraction
To extract enzymes from lemons, 2 g of tissue from each fruit was collected. Tissues were placed in 20 mM Tris-HCl buffer (pH 7.2) and homogenized using a homogenizer. The homogenate was poured into glass tubes and centrifuged at 10,000 rpm at 4 °C for 10 min. Next, the supernatant was designated as crude extract and stored at − 20 °C for later determination of PPO and POD activities.
POD activity
POD activity was measured according to Bereika et al. (2020) with some modifications. Each prepared reaction mixture was 1 mL in total and contained 0.25 mL (0.2 M) sodium acetate (pH 5.5), 8 μL (0.97) M H2O2, 0.08 mL (0.5 M) guaiacol, and least amount of enzyme preparation. The change in absorbance at 470 nm reflecting guaiacol oxidation was then followed for 1 min using a spectrophotometer. Under standard assay conditions, the amount of enzyme that caused an increase in absorbance of at 1.0 O.D per min was defined as one unit of enzyme. Extraction buffer alone served as a blank reference sample. Three replicates were used for each treatment.
PPO activity
PPO activity was determined, following protocols from Batra and Kuhn (1975) using catechol as a substrate. A catechol solution (20 mM) was prepared using 0.01 M Na3PO4 (pH 6.8); then, 0.2 mL extract was added as quickly as possible to 2.8 mL catechol. Using a spectrophotometer, the change in absorbance at 400 nm was recorded for 2 min. An enzyme activity unit was defined as the amount of enzyme that caused an absorbance change of 0.1 in 1 min under standard assay conditions. Extraction buffer alone served as a blank reference. Three replicates were measured for each treatment.
Non-enzymatic assays
Sample preparation
For flavonoid and phenolic compound extraction, 1.0 g sample was suspended in 10 mL 70% ethanol (v/v). The suspension was then placed at 30 °C on a shaker at 120 rpm for 2 h and then centrifuged at 1013×g for 5 min. The resulting supernatant was used for further analysis.
Total phenol content
The total phenol content of each sample was measured by the method established by Malik and Singh (1980). Methanol extracts (50 μL) of each sample or standard (gallic acid) were mixed with 850 μL methanol, 100 μL Folin-Ciocalteu reagent was added, and samples were left at room temperature for 5 min. Next, samples were mixed with 500 μL 20% Na2CO3 and incubated at room temperature for 30 min to react. The absorbance of each sample at 750 nm was then measured, and the total phenol content was calculated based on a standard curve. The standard curve was prepared using gallic acid, and the phenol content in each extract was expressed as mg of gallic acid/g of fresh weight. Phenol content measurements were performed twice with three replicates.
Total flavonoid content
Using the modified colorimetric assay reported by Zhishen et al. (1999), flavonoid concentrations in each sample were determined. A 250-μL aliquot of standard (catechin) or methanol extract was mixed with 75 μL 5% NaNO2 and 1.25 mL sterile distilled water. The reaction mixture was left for 6 min and then mixed with 150 μL 10% AlCl3, 0.5 mL (1 M) NaOH, and 275 μL sterile distilled water was added to solution. The absorbance of each solution was measured at 510 nm, and the total flavonoid content was calculated using a standard curve. Known concentrations of catechin were used to generate a standard curve, and the results were described as mg of catechin equivalent/g.
Statistical analysis
Experimental data were analyzed using the statistical package Statistix (ver. 8.1), and two-way ANOVA was used. The least significant difference test at P = 0.05 was performed for disease severity and disease incidence means to identify meaningful differences between the means of results of various treatments. Data were expressed as mean ± SE.
