Insect and viruses
S. littoralis used for virus propagation and bioassay experiments was derived from the insect-rearing facility of the Agricultural Genetic Engineering Research Institute, Agricultural Research Center, Giza, Egypt. The larvae were maintained at 26 °C with 60% RH. Larvae were reared on a semi-artificial diet containing agar-agar, maize meal, wheat germ, brewer’s yeast, ascorbic acid, and Nipagien (methyl 4-hydroxybenzoate) previously described by (Ivaldi-Sender 1974). Viruses used in this study were field-collected baculovirus isolate genus nucleopolyhedrovirus from infected cadavers from Giza district in Egypt.
Virus propagation in S. littoralis larvae
The S. littoralis larvae (4th instar) were placed in boxes (50-well plate) with a small piece of insect medium. Each piece of media was inoculated with 105 of virus occlusion bodies (OBs), then the plates were incubated at 26 °C. The next day, larvae were transferred to virus-free medium and continued rearing until observation of viral infection symptoms (7–10 days post-infection).
Virus purification from infected larvae
Infected larvae were collected for virus purification according to Boughton et al. (1999). Using 0.1% SDS, infected larvae were homogenized and the suspension that formed from the grinded larvae was filtered by using a piece of cotton and filter paper. Excess of 0.1% SDS was added until the filter paper became clear. The grinded tissues containing virus occlusion bodies (OBs) were centrifuged at 7000 rpm for 10 min at room temperature. The supernatant was discarded, and the pellet was re-suspended in 1 ml 0.5% SDS/larva using vortex then centrifuged again at 7000 rpm at room temperature for 10 min. The pellets were re-suspended in 0.5 M NaCl by vortex, then centrifuged again at 7000 rpm for 10 min. The pellets were suspended in a small volume of ddH2O (0.5 ml/larvae) by pipetting or gentle vortex. The diluted OBs were counted in the dark field of the Axiovert Zeiss inverted microscope with a × 200 magnification, using a Petroff-Hauser counting chamber (depth 0.01 mm, Hausser Scientific). The purified virus was kept frozen at − 20 °C.
Purification of virus DNA
Using the method developed by Boughton et al. (1999), viral genomic DNAs were isolated from viral OBs. Briefly, about 300 μl of purified virus OBs was precipitated for 10 min at 7000 rpm, and pellet-containing viral OBs were re-suspended in 200 μl of H2O. 1 M of Na2CO3 (sterile filtrated) in the final concentration of 0.1 M was added then incubated for 1 h at 37 °C in water bath till the solution became clear. The solution was neutralized with autoclaved 1 M HCl to pH 8, and 10% (w/w) SDS solution was added in the final concentration of 1%. Then, proteinase K was added in the final concentration of 250 μg/ml, and the suspension was incubated for 1 h at 37 °C to release the nucleic acids. The samples were washed twice with TE buffer-saturated phenol/chloroform 1:1 (v/v) and one more time with chloroform to remove the phenolic traces. Viral genomic DNA was precipitated using 2.5 volume ice-cold 96% ethanol and 1/10 volumes 3 M NaAc pH 5.2 in − 80 °C and then washed twice with 70% ethanol. The pellet was dried for 5 min at RT, then DNA was eluted in a suitable amount of autoclaved water.
Restriction profile analysis
Restriction digestion of the viral DNA was performed to compare the genome pattern of virus isolates, using ScaI endonuclease. Briefly, 1–1.5 μg genomic DNA was digested, using the following component: 9 μl of viral DNA, 1 μl of the appropriate enzyme (5 U/μl), 2 μl 10× buffer, and 7 μl of ddH2O. The mixture then was incubated for 2 h at 37 °C. Electrophoresis was performed overnight, using 0.8% agarose in 1XTAE buffer (40 mM Tris, 20 mM acetate, and 1 mM EDTA, pH 8.6) (Boughton et al. 1999).
PCR amplification of polyhedrin gene
One set of polyhedrin-specific primers, designed and synthesized based on the reference strain SpliMNPV-AN1956 (Accession No. NC_038369) Breitenbach et al. (2013), was used to partially amplify polyhedrin fragment from each virus genomic DNA. Primers denoted Spli-polh-560_F (5′-ATCTGGGCAAAACCTATGTAT-3′) and Spli-polh-560_R (CTTGGCGAGACTGATGCGGTATTC). The PCR reactions were performed in a total reaction volume of 50 μl containing 1 μl of the appropriate upper primer (10 pmol/μl), 1 μl of the appropriate lower primer (10 pmol/μl), 1.5 μl MgCl2 (50 mM), 1.5 μl of dNTPs mixture solution (10 mM), 2 μl of DNA template (0.1–0.5 μg), 5 μl of 10× PCR reaction buffer, and 0.5 μl of Taq DNA polymerase (5 U/μl). The reaction volume was completed to 50 μl, using autoclaved bdH2O. For a typical PCR reaction, the following program was used: an initial 95 °C for 3 min; a total of 30 cycles of denaturation at 95 °C for 1 min, primer annealing at 59 °C for 1 min, and primer extension at 72 °C for 1 min; and a final cycle at 72 °C for 7 min to allow the completion of primer extension. PCR-amplified DNA was analyzed by electrophoresis on a 1% agarose gel prepared in 1× TAE buffer. The PCR products were purified using the Qiaquick PCR purification kit (Qiagene, Germany). Nucleotide sequences for the purified fragments were performed using the Sanger sequence.
Sequencing and phylogenetic analysis
Analysis of the polyhedrin-deduced amino acid sequences was performed for both isolates, using EditSeq-DNAstar Inc., Expert Sequence Analysis software, Windows 32 Edit Seq 4.00 (1989–1999), ExPasy database, and Clustal Omega for multiple alignment analysis. Blastp search for alignment of the resulted deduced amino acid sequences with the published ones was carried out, using the database of the National Center for Biotechnology Information (NCBI).
The LC50 and ST50
To determine the median lethal concentration (LC50) for each isolate, 6 different concentrations were prepared for each virus suspension as follows: 103, 5 × 103, 104, 5 × 104, 105, and 5 × 05 OBs/ml, in addition to the control solution, which contains ddH2O instead of virus suspension. Two plates (50-well) were used for each experiment in addition to 2 plates for the control treatment. The volume of each virus concentration was completed to 10 ml with water and added to 90 ml larval media (40 °C) that were prepared in advance, then the mixture of media and virus suspension was poured on the plates. After solidification, larvae were added to all plates and incubated for 24 h, then handling error was taken by counting the dead larvae. After 7 days, dead larvae were counted and the LC50 were analyzed, using EPA Probit analysis program (version 1.5). Another way of infection was introduced using a mixed infection by mixing Spli-6 and Spli-7. An equal volume of each isolate OBs was added to the mixture. This mixture was used to prepare serial dilution of virus-infected inoculum that was used to infect larvae in a bioassay experiment as mentioned before. Moreover, the median survival time (ST50) was determined by inoculating 50 individually held larvae in 3 replicates with the calculated LC80 for each tested virus, as well as 2 control plates, which were mixed by water instead of virus suspension. The mortality of the larvae was monitored every 24 h, starting day 3 post-infection until day 7 or larval death. Data analysis was performed, using the Kaplan-Meier survival time estimator analysis (Kaplan-Meier 1958).
