Strain-specific identification of Beauveria bassiana isolated from a novel habitat, using rDNA-based sequence analogy

Field sites and collection of soil sample

The field of study was conducted from soil sample of Bogidhola Tea Estate, Golaghat district, Assam, India. From the site, four soil samples were collected within 100 m to each other and labelled (S1, S2, S3, and S4). Five hundred grams of each soil sample was taken from the top 10 cm of the soil surface. Afterwards, the samples were air dried at room temperature for 7 days followed by passing through 0.71-mm mesh sieve and were subsequently packed in plastic bags (Suzuki et al., 1999 and Safavi, 2010).

Screening of microorganisms present in the collected soil samples

Thirty grams of Sabouraud’s dextrose agar (SDAY) media, a tailor-made media composed of dextrose (20 kg/m³), mycological peptone (10 kg/m³), agar (kg/m³), and yeast extract (1%), was prepared by dissolving into 1-L de-ionised water followed by pouring in four separate petri dishes (P1, P2, P3, and P4) and left to set. The pH of the media was maintained at 5.8 during the course of procedure. Next, 1 g of soil sample was taken from each of the S1, S2, S3, and S4 and inoculated in SDAY media of P1, P2, P3, and P4, respectively. Subsequently, all petri dishes were kept in total darkness at 298 K for 5 days. P1, P2, and P4 were selected for subculture and isolation of B. bassiana with profused conidia growth (Safavi, 2010 and Mondal et al., 2015).

Primary screening: isolation of entomopathogenic fungi

Isolation of pure spore culture of entomopathogenic fungi is crucial for developing pure mycelia of B. bassiana. Another tailor-made media (PDAD media), consisting of potato dextrose agar supplemented with 1 g/L yeast extract, 0.0004 kg chloramphenicol, 0.00004 kg streptomycin, 4 units of penicillin, 0.05 g/L gentamicin, and 0.004% active ingredient dodine, were prepared in order to endorse the growth of entomopathogenic fungi only. Commercial fungicide ‘Syllit’ (65% active ingredient) was used as the source of dodine. The pH of PDAD media was maintained at 6.9 throughout the study. While chloromphenicol, being a broad spectrum antibiotic, inhibits the growth of a wide-range Gram-positive and Gram-negative bacteria, the combination of streptomycin, gentamycin, and penicillin inhibits the bacterial and yeast growth. After preparing, PDAD media were poured in a petri dish (P5) and left to set. Afterwards, a subculture was done on the P5 with the inocula taken from each of the mycelia developed on P1, P2, and P4. Prolific growths of entomopathogenic mycelia were observed in the subcultured media (P5) after 5-day incubation at 298 K temperature in total darkness. A control strain of B. bassiana (strain ARSEF502) was also grown under similar incubation conditions on the PDAD media. Identification of B. bassiana mycelia grown in P5 was achieved by comparing the growth morphology with those mycelia growth of B. bassiana control strain (Fernandes et al., 2010).

Development of pure B. bassiana mycelia

Mycelia of B. bassiana were further harvested from the mycelia subculture developed in P5 by a microbiological loop and immediately suspended in a 0.01% tween 80 solution, following vortexes for 30s. Next, 20-μL aliquot of mycelia suspension was transferred to a petri dish (P6) containing PDAD media, following incubation for 5 days under 298 K at total darkness. A pure mycelia growth of B. bassiana was observed on the surface of the P6 and hence confirmed by comparing to the mycelia growth of B. bassiana control strain. Afterwards, mycelia of B. bassiana isolate, developed in the P6, were removed from the agar surface with a sterile scalpel and transferred to a sterile petri dish. Subsequently, mycelium was cut into small pieces (less than 0·5 mm) with a sterile scalpel and was transferred in 100-ml Potato Dextrose broth. After 1 week, the dried pure mycelia of the fungal isolate were harvested by centrifugation and stored in a freezer. Additionally, lactophenol cotton blue staining was done in order to identify the nature of the fungus grown in P6 containing PDAD (Al-Samarrai and Schmid, 2000; Castrillo et al., 2003 and Fernandes et al., 2010).

A purified mycelium culture of isolated B. bassiana strain, developed over P6, is illustrated in Fig. 2.

Fungal DNA extraction

In a 1.5-ml centrifuge tube, 0.005 g of dried pure mycelia was suspended in a solution composed of 150 μl of 10%(w/v) sodium dodecyl sulfate, 500 μl of Tris buffer (100 mm Tris HCL, pH 8.0, 40 mM ethylene diamine tetra acetic acid [EDTA]), and 300 μl of Benzyl Chloride and consequently incubated at 55 °C for 30 min. Subsequent treatment with RNase (1 mg/ml) and phenol:chloroform:isoamylalcohol (25:24:1) was undertaken in order to remove proteins. Afterwards, the tube was vortexed at 10000×g for 1 min, and next, the supernatant was separated. After that, DNA was precipitated from supernatant by adding 2.5 volumes 100% ice-cold ethanol. Then, the DNA pellet was washed carefully with 2 volumes of 70% ethanol and then re-suspended with distilled water (Urtz and Rice, 1997 and Park et al., 2001).

PCR amplification and sequencing of the D2 region of the large subunit (28S) rDNA gene

The nuclear rDNA segment corresponding to the D2 region of fungal 28S ribosomal RNA (28S-D2 rDNA) was amplified through polymerase chain reaction (PCR), carried out using a Perkin-Elmer GeneAmp PCR System 2400. LF402Fmix1 [sequence: GTGAAATTGYTRAAAGGGAA] and LF402Fmix3 [sequence: GTGAAATTGTCAAAAGGGAA] were used as forward primers whereas, TW13 [sequence: GGTCCGTGTTTCAAGACG] and LR3 [sequence: GGTCCGTGTTTCAAGAC] were used as reverse primers with the aim of amplifying D2 region of 28S rDNA only (Porter and Golding, 2012 and Tedersoo et al., 2015). PCR procedure was initialized with the denaturation of DNA template strands at 95 °C for 5 min, followed by 30 cycles of amplification (denaturation at 95 °C for 1 min succeeding annealing at 45 °C for 1 min and next extension for 1 min at 72 °C) and then final extension for 5mins at 72 °C. Purification of amplified DNA product, following isolation, was done in a mandatory basis prior to sequencing of that amplified DNA. The amplified DNA was excised in × 0.5 TBE buffer by gel electrophoresis in a 1.6% agarose gel supplemented with the ethidium bromide with the purpose of isolating and purifying it, and a single discrete PCR amplicon band of 700 bp was observed in agarose gel (Fig. 3).

The isolated and purified DNA was extracted from agarose gel, using a QIAGEN gel elution kit (Qiagen, Wartworth, CA). Afterwards, direct sequencing of the PCR products was done, according to the manufacturer’s protocol, by a ABI 3730xl Genetic Analyser (ThermoFisher scientific) with a BDT v3.1 Cycle sequencing kit (ThermoFisher scientific). LF402Fmix1 primer and TW13 primer were used for sense and antisense sequencing, respectively (Park et al., 2001 and Park et al., 2002, and Ninet et al., 2003).

Data analysis

A consensus sequence of rDNA portion corresponding to D2 region of 28S rRNA of isolated Beauveria strain was found, using aligner software, with the help of sense and antisense sequencing. The consensus sequence found was further used to carry out BLAST in order to find out organisms from NCBI database having the exactly same sequence spanning the D2 region of 28S rDNA. Based on a maximum identity score achieved from BLAST, strains, having exactly same or nearly same sequence across the D2 region in 28S rDNA, were selected. The inferred rDNA sequence has been deposited in the NCBI database. A phylogenetic tree was constructed by neighbour-joining method using MEGA version 5.0 with an aim to comprehend the evolutionary relationship among the isolated Beauveria strain and other closely related taxa, and the strength of the internal branches of the consensus tree were statistically tested from 1000 bootstrap replication analysis. Kimura 2-parameter model was chosen for neighbour-joining-based phylogenetic tree reconstruction and evolutionary distance computation in the units of the number of base substitutions per site (Park et al., 2001).

Presence of Beauveria bassiana in the soil sample of other tea gardens

In order to discover whether the presence of B. bassiana is mandatory for insect pest control or not, an additional study was conducted with the aim of determining the presence of the tested fungi in the soil of other tea gardens situated at Golaghat district. Soil samples were collected from each of the tea gardens situated at Golaghat district, followed by attempting isolation of B. bassiana from their respective soil samples. From collection of soil samples to isolation of B. bassiana have been completed according to the same procedure followed during the fungal isolation from Bogidhola Tea Estate soil.

Sequence alignment

Only a single band of 700 bp was achieved by gel electrophoresis of PCR products (Fig. 3). Therefore, it can be inferred that a particular segment of template rDNA was amplified and isolated by agarose gel electrophoresis. Additionally, direct sequencing procedure also confirmed the results.

With the help of direct sequencing procedure, a sequence of 570 bp (FS1) (5′-AACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAAT TTGAAATCTGGCCCTCGGGTCCGAG TTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGAAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGCGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGAAAAAGGCTTCGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCGCTGCGTAATACCCTGCGCCGGACTGAGGTACGCGCATCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAA) was found by the sense primer LF402Fmix1 and a reverse sequence of 570 bp (RS2) (5′-CAGCATCCTTGCGATGCGCGTACCTCAGTCCGGCGCAGGGTATTACGCAGCGGGCTATAACACTCCCGAGGGAGCCACATTCCCGAAGCCTTTTTCCCCCGCGCCAAACTGATGCTGGCCTGTGCCCGGCAAAGTGCACCAGCGAGAACGCTGGATGATTCACCGGGCGCAAGTCTGGTCATAGGCGCTTCCCTTTCAACAATTTCACGTACTTTTTAACCCTCTTTTCAAAGTGCTTTTCATCTTTCGATCACTCTACTTGTGCGCTATCGGTCTCTGGCCAATATTTAGCTTTAGAAGACATATACCTCCCATTTTGAGCAGCATTCCCAAACTACTCGACTCGTTGAAGGAGCTTTACAGAGGCTCGGTGTCCGACCAGACGGGGCTCTCACCCTCTATGGCGTCCCGTTCCAGGGAACTCGGAAGGCACCTCGCCAAAAGCATCCTCTACAAATTACAACTCGGACCCGAGGGCCAGATTTCAAATTTGAGCTGTTGCCGCTTCACTCGCCGTTACTGGGGCAATCCCTGTTGGTTTCTTTTCCTCCGCTTATTGATATGCTTAAT) was found by antisense primer TW13.

With the help of aligner software, FS1 and RS2 were compared in order to find out the consensus sequence, and therefore, a consensus sequence of 600 bp (CS) (5′-ATTAAGCATATCAATAAGCGGAGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTCGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCAACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGCGCCCGGTGAATCATCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTTGGCGCGGGGGAAAAAGGCTTCGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCGCTGCGTAATACCCTGCGCCGGACTGAGGTACGCGCATCGCAAGGATGCTGGCGTAATGGTCATCAGCGACCCGTCTTGAA) was found and considered as the consensus sequence of D2 region of 28S rDNA.

Based on the BLAST search, presented in Table 1, the CS sequence of isolated B. bassiana showed maximum identity (100%) with fungal strain CCFC225554 (accession no: AY283555.1). The consensus DNA sequence, derived from D2 region in 28S rDNA of B. bassiana isolated from Bogidhola Tea Estate, was deposited in NCBI database under the accession no KT359346.

Phylogenetic analysis

Whether the values represent the rate of nucleotide base substitution, values on top upper right of the matrix represent rates of transversion (A or G C or T) and the values on the lower left represent rates of transition (A G;C T). From the matrix, it could be observed that B. bassiana isolate had a nucleotide substitution score of 0.000 with AY283555.1 and had a maximum nucleotide substitution value of 0.019 with KC510278.1 and HQ591387.1. Therefore, based on the score achieved from distance matrix, it could be concluded that there was no variation in nucleotide alignment spanning D2 region in 28 s rDNA of isolated B. bassiana and its strain AY283555.1 (Park et al., 2002; Holmes, 2003 and Soltis and Soltis, 2003).

Based on the homology of sequence across D2 region in 28S r DNA of isolated Beauveria strain with 15 other closely related strains cited from gene bank, a phylogenetic relationship is assessed and presented in Fig. 4.

In the figure, horizontal lines, considered as branches, represent evolutionary lineages changing over time because of nucleotide substitution. The amounts of changes were directly proportional to the length of the branches in horizontal dimension. A phylogenetic tree was generated from original dataset with the aid of neighbourhood-joining method. Additionally, 1000 bootstrap pseudoreplicate datasets of original dataset were carried out, followed by generation of phylogenetic tree against each of the bootstrapped data sets. Afterwards, the topology of the trees, generated from bootstrap data sets, was compared to the topology of the original phylogenetic tree, with an aim to infer the bootstrap consensus phylogenetic tree and taken to represent the evolutionary history of the isolated B. bassiana strain. During the topology comparison, based on the support of the each node, bootstrap values were assigned against each interior branch node of original tree. As bootstrap value was used to verify the solidity of each node, bootstrap values of 95% or greater was considered statistically significant whether nodes can be rejected if they occur in less than 5% of the bootstrap estimates. Although two nodes in consensus phylogenetic tree somewhat achieved comparatively low bootstrap replication values (31 and 33%), but other nodes were supported by bootstrap values between 93 and 100%, which were statistically significant and indicate ‘support’ for a clade (Park et al., 2002; Peterson, 2008 and Ergashev et al., 2009).

The branches holding AY283555.1 and isolated B. bassiana strain were originated from a single node, containing a bootstrap value of 99, where both branches had the same length and described that both had been evolved from same ancestor, with exactly equal and same genetic changes (Fig. 4). Whether bootstrap value of 100 signifies the maximum support of respective nodes, the node holding the AY283555.1 and branches achieved a bootstrap value of 99 which was almost proximate to 100. Bootstrap value of 99 at the inner node means that the species AY283555.1 and B. bassiana isolate were siblings in 99% of the bootstrap replications and were grouped together in monophyletic clade in 99% of the bootstrap replications (Park et al., 2002; Peterson, 2008 and Ergashev et al., 2009). Additionally, even though AY184966.1and HQ591387.1 were also grouped in a monophyletic clade attaining bootstrap replication value of 99, but they were originated from an entirely different node as their ancestor was different from the ancestor evolved to generate AY283555.1 and B. bassiana isolate. This result is consistent with that of D2 region of LSU rDNA sequence analysis.

Presence of Beauveria bassiana in other tea garden soil samples

Although a very poor mycelial growth was found on a few petri dishes inoculated with the soil samples taken from other tea gardens, their occurrence was ignored as their mycelia growth was found very poor compared to the mycelia growth of B. bassiana, found in P1, P2, P3, P4, P5, and P6. However, the growth of B. bassiana was not observed on most of the petri dishes, following inoculation with the soil of other tea gardens. It was revealed from the nutritionists of Bogidhola Tea Estate that, in addition to the regular nutritional components, they often add shrimp powder into the soil, as a nutritional supplement. Rao et al. (2006) reported that shrimp powder was a good source of carbohydrate entitled trehalose which supported the development and growth of B. bassiana (Campbell et al., 1983 and Rao et al., 2006). With this information, it could be concluded that supply of trehalose into the soil of Bogidhola Tea Estate endorses the growth of B. bassiana in soil. On the contrary, no such additional nutritional supplements, containing trehalose, have been supplied to the soil of the other tea gardens, and for this reason, a very insignificant existence of B. bassiana was found in their soil.