Isolation and evaluation of indigenous endophytic entomopathogenic fungus, Beauveria bassiana UHSB-END1 (Hypocreales: Cordycipitaceae), against Spodoptera litura Fabricius

Abstract

Background

Microbial biological control agents are gaining worldwide attention to manage insect pests as an alternative to synthetic insecticides. Entomopathogenic fungi (EPF) meet eco-friendly pest management’s demand since mere contact of infective propagules is sufficient to cause disease in insect pests, unlike other entomopathogens. However, epiphytic fungal isolates encounter multiple challenges including direct exposure of conidia to sunlight and UV light, high temperature, and low moisture content that reduce their efficacy at the field level. Therefore, utilization of endophytic EPF is becoming more popular because they get protection from adverse conditions compared to the epiphytic EPF as they reside inside the host tissue. In addition, the endophytic EPF also give protection against crop diseases and promote plant growth, degradation of heavy metals, and tolerance to abiotic stress.

Results

The increased mortality of Spodoptera litura (Fab.) (Noctuidae: Lepidoptera) was achieved through endophytic colonization of indigenous Beauveria bassiana UHSB-END-1 (OM131742). The bioassay proved the highest mortality 2nd instar larvae of S. litura at 40 dpi, both in vivo and in planta experiment. Further, larvae fed with fungal colonized leaves of tomato plant ended with abnormal growth and developmental process. The recovery of B. bassiana from different plant parts (stem, leaves, and roots) was the highest (100%) in all the methods of colonization at 14, 40, 60, 80 dpi, and it was decreased at 120 dpi (80%). The colonization rate was again increased in the next-generation seeds and seedlings (25 days old). This isolate gets vertically transmitted to their progenies via seeds, and it is the first report in tomato crop.

Conclusion

After ensuring the safeness of this isolate against non-target organisms, it can be one of the constitutes in sustainable cost-effective strategy for management of pests affecting tomato as one of the components in integrated pests management. Inoculation of endophytic EPF into seed/seedling reduces environmental impacts and also easy, economical, and sustainable approach for pest management in horticulture crops which are often consumed as raw. Although field studies are required to support the present finding, this appears to be an interesting tool that should be considered for pest biocontrol.

Background

Tomato, Solanum lycopersicum L. (Solanaceae: Solanales), is one of the world’s major fresh and processed fruits and is the second most important vegetable crop after the potato worldwide. China, the European Union (EU), India, the USA, and Turkey are the major producers of tomatoes accounting for 70% of global production in 2020. The intensive cultivation of tomatoes either in the open field or under protection (greenhouses) and climate change had led to the emergence of multiple pests and diseases, causing significant yield loss annually. The tobacco leaf-eating caterpillar, Spodoptera litura Fabricius (Noctuidae: Lepidoptera), is the top most pest causing a substantial yield loss in tomato production (Mahapatra et al. 2018).

Management of pests with repeated sprays of synthetic chemical insecticides is the most common management practice, followed by farmers. However, insect pests develop resistance against insecticides rapidly. Therefore, the use of insecticides is inefficient in managing insect pests in the long run and also increases the cost of production. Synthetic chemicals are also harmful to non-target organisms and the ecosystem (Sharma et al. 2020). Currently, there is a huge demand for efficient, environmentally safe, and sustainable methods of insect pest management.

Interestingly, microbial biological control agents (mBCAs) are gaining worldwide attention to managing insect pests as an alternative to synthetic insecticides. Entomopathogenic fungi (EPF) meet eco-friendly pest management's demand since mere contact of infective propagules is sufficient to cause disease in insect pests, unlike other entomopathogens such as bacteria, viruses, and nematodes. In addition, they have advantages of ease of isolation and mass production, easy handling of formulations, and field application (Litwin et al. 2020). However, epiphytic fungal isolates for pest management encounter multiple challenges that reduce their efficacy at the field level. The hurdles include direct exposure of propagules (conidia) to sunlight and UV light, higher temperature, and lower moisture content in the environment (Vega 2018). Therefore, the biological management of pests using traditional isolates of fungi is not popular at the field level and attracts less interest among the farming community.

The utilization of endophytic EPF is becoming more popular for pest management in recent days that overcome the limitations of epiphytic EPF (Agbessenou et al. 2020). The endophytic EPF gets protection from adverse environmental conditions compared to the epiphytic EPF as they reside inside the host tissue. In addition, the endophytic EPF also give protection against crop diseases (Mantzoukas and Eliopoulos 2020) and promote plant growth and development through symbiotic association with the host plant for the entire crop period (Kusari et al. 2012). Endophytic EPF favor plant growth by increased nutrient uptake (Yuan et al. 2018), degradation of heavy metals in the rhizosphere (Jaber 2018), and tolerance to abiotic stress (Jaber and Enkerli 2016). The colonization of endophytic fungi in the host plant triggers the production of defensive bioactive compounds of antimicrobial and insecticidal properties. Such compounds get accumulated as a reservoir of preformed defense compounds (Lin et al. 2016). Consequently, plants can conserve the energy that would have been used in the production of defensive compounds against biotic stresses during the initial stages of the infection (Shrivastava et al. 2015). As the growing period of plants advances, the incidence of insect pests and diseases can be suppressed by the combined effect of bioactive compounds produced from both endophytic fungi and host plants (Gualandi et al. 2014).

Endophytic EPF, Beauveria bassiana (Bals.-Criv.) Vuill. (Hypocreales: Cordycipitaceae) is one of the hardy EPF, well adapted to the diverse cultivated crops, and protects against insect pests without showing any external symptoms on the plant. Its colonization has been detected in different parts of the plants such as root, stem, and leaf in various field crops and horticultural crops (Reay et al. 2010). The colonization of endophytic B. bassiana has been reported in tomato, potato, cucumber, melon, maize, cotton, rice and demonstrated to protect against multiple insect pests and diseases (Vega 2018). In tomatoes, the efficacy of the endophytic B. bassiana as a biocontrol agent against insect pests varies with inoculation methods and location-specific isolates (Sinno et al. 2020).

Therefore, an indigenous isolate of endophytic fungus B. bassiana was isolated from the Ghataprabha region, a biodiversity hotspot in the Krishna river basin of Western Ghats. Its identity, colonization, and recovery in different tissues of tomatoes were confirmed through molecular techniques. The bio-efficacy of the newly isolated B. bassiana for the management of S. litura was tested under in vivo (tested under laboratory conditions) and also their efficacy study under in vitro (open conditions) at different crop growth period.

Methods

Isolation and characterization of Beauveria bassiana

Isolation of endophytic fungus

For isolation of EPF, leaves, stem, and roots were collected from the tobacco leaf-eating caterpillar infested tomato plants cultivated at Ghataprabha, Gokak taluk, Belagavi district, Karnataka, India (16.23950 N, 74.7580 E). A total of 50 plants were collected randomly covering five fields in the said taluk for tissue sampling. Collected tissues were surface sterilized with 2% sodium hypochlorite for 2 min, treated with 70% alcohol for 3 min, and later thoroughly washed thrice with sterile water. The last rinsed water was plated on PDA medium and incubated to ensure the surface sterilization, and no colonies of fungus were grown on the plate. Sterilized tissues were blotted on sterile filter paper under a laminar flow hood for 45 min to drain the residual water. Tissues were transferred to the Petri plates containing Potato Dextrose Agar (PDA) medium. The Petri plates were incubated at 25 ± 2 °C in a BOD incubator for seven days. The pure culture of the endophytic fungi was isolated by transferring the hyphal tip from 7-day-grown colony to the PDA slants and cultured at 25 ± 2 °C.

Morphological identification

Morphological identification of the endophytic fungi isolated from tomato plant was carried out by observing the colony features (color and texture) of the fungal isolate grown for seven days on a PDA medium. The microscopic characteristics of the fungus were studied based on conidia, conidiophores, and arrangement of spores under a compound microscope (Euromex iScope, Holland).

Molecular identification

The total genomic DNA of the fungal isolate was extracted from the mycelium of the 7-day-old cultures grown on Potato Dextrose Broth (PDB). The mycelia were collected by filtering out the culture through Whatman’s filter paper No.1 (125 mm). Mycelium was frozen in liquid nitrogen and ground into fine powder in TissueLyser II (Qiagen, Venlo, Netherlands). The fungal genomic DNA was extracted by CTAB protocol with slight modifications. PCR amplified the fragment of Inter Transcribed Spacer (ITS) region with fungal specific ITS primers; ITS 4-forward primer (5′ TCCGTAGGTGAACCTGCGG 3'), ITS 4-reverse primer (5′ TCCTCCGCTTATTGATATGC 3′). The amplified PCR product was purified and sequenced on ABI PRISM 3730xL Genetic Analyzer (Thermo Fisher Scientific Company, USA). Quality check was performed on the sequence chromatograms using Codon Code Aligner Version 1.2. The ITS sequences of newly isolated endophytic fungi were submitted to the GenBank, and an accession number was obtained. Fasta sequences were BLAST searched against the non-redundant nucleotide database of NCBI (http://blast.ncbi.nlm.nih.gov/ accessed on 5 January 2022). Multiple sequence alignment of ITS sequence of the newly isolated strain of B. bassiana and its homologous sequences was constructed using the MUSCLE program. The phylogenetic tree was built following Neighborhood Joining (NJ) method with 1000 bootstrap values using MEGA X software. v11 (Kumar et al. 2018).

Plant material

Tomato seeds of Arka Rakshak were procured from ICAR-Indian Institute of Horticultural Research, Hesaraghatta, Bengaluru. Seeds were surface disinfected with 2% sodium hypochlorite for two minutes, followed by 70% alcohol for three minutes, and later consecutively washed thrice with autoclaved ultrapure water. The disinfected seeds were dried on sterile filter paper under a laminar airflow hood for 30 min and used for the study. The efficacy of surface sterilization was tested by incubating surface-sterilized seeds onto a PDA medium. Microbial growth was not observed after one week of incubation.

Insect cultures

The wild population of test insects, S. litura, was collected from vegetable fields of the College of Horticulture, Bagalkot, India (16.16910 N latitude, 75.66150E longitude). The culture of the insect was reared on tomato leaves under laboratory conditions of 28 ± 1 °C with natural photoperiodic conditions. The second instar larvae were collected from the insect culture as and when required for the in vivo and in vitro study (Sowmya et al. 2017).

Conidial preparation

The pre-cleaned rice grains were soaked in an equal ratio of distilled water (200 g: 200 ml) in polythene bags added with dry yeast (2 g) and 0.2 g of chloramphenicol antibiotic to avoid bacterial contamination. The mixture was autoclaved (121 °C, 15 lbs pressure) for 30 min and allowed to cool and later inoculated with mother fungal culture (B. bassiana UHSB-END1) under a laminar airflow hood. The inoculated bags were incubated at 25 ± 2 °C for 15 days under dark conditions. After 15 days, the fully grown fungus on rice grains was powdered and added with talc powder (1:1) as a talc-based formulation. The spore load of 1 × 10⁸ cfu/g was maintained in the formulation.

Experimental design

Raising of seedlings

The treated and untreated seeds were sown in pro-trays filled with sterilized potting media (coco peat) placed in a growth chamber (Alice Biotech Pvt. Ltd.). The germinated seedlings were grown for 25 days in pro-trays and then transferred into the pots for imposing different treatments filled with autoclaved soil and compost (1:1).

Treatment design

A completely randomized design of six treatments was laid out. Each treatment was replicated thrice with ten plants per replication. Different treatments used to colonize endophytic B. bassiana UHSB-END1 in the tomato plant were detailed below.

Seed treatment

The tomato seeds were soaked overnight (12 h.) in freshly prepared fungal conidial suspensions (5 g/l). The soaked seeds were dried for 30 min under a laminar airflow hood and later sown in pro-tray. After 25 days, they were transplanted to the pots for colonization study (Jaber and Enkerli 2016).

Seedling root dip treatment

Roots of 25-day-old seedlings raised in portray were dipped in conidial suspension (5 g/l) for about two hours and then immediately transplanted to pots containing sterilized media (Saragih et al. 2019).

Soil drenching

After two days of transplanting tomato seedlings, the pots were drenched with 500 ml of conidial suspension (10 g/l) (Greenfield et al. 2016).

Foliar Spray

After two days of transplanting tomato seedlings to the pots, the conidial suspension (4 g/l) was sprayed to the entire plant (Greenfield et al. 2016).

Colonization of B. bassiana UHSB-END1 in tomato plant

Per cent colonization

The endophytic colonization and persistence of B. bassiana UHSB-END1 in the tomato plants were recorded after 14, 40, 60, 80, and 120 days of post-inoculation (dpi). Tomato plant parts (leaves, stem, and root) from different treatments were collected by destructive sampling. Collected plant parts were surface sterilized using the protocol as mentioned in the isolation of fungi from plant parts. The six bits of surface-sterilized stem, leaf, and root of tomato plant parts were transferred to the Petri plates containing Potato Dextrose Agar (PDA) and incubated at 25 ± 2 °C for seven days. After seven days of incubation, the colonization percentage was calculated as detailed below (Petrini and Fisher 1986).

$${\text{Colonization }}\left( \% \right) \, = {\text{ PF}}/{\text{TP }} \times 100$$

where PF is the number of pieces exhibiting fungal growth and TP is the total number of pieces plated.

Molecular confirmation of endophytic colonization of B. bassiana UHSB-END1 in the tomato plant

Extraction of plant DNA and quantification

The genomic DNA of B. bassiana UHSB-END1-colonized and non-colonized tomato plants was extracted after 14, 40, 60, 80, and 120 dpi and next-generation seeds and seedlings of 25 days old using CTAB protocol (Zhang et al. 2010) with slight modification. The isolated DNA was quantified using the nano-drop (Thermo Fisher Nano-drop TM 2000/2000c). The appropriate required quantity of genomic DNA to run PCR was diluted with sterile nuclease-free water.

Specific PCR protocol

All PCRs included a positive control (DNA of mother culture of B. bassiana) and negative control (PCR mixture except template). The PCR mixture contained 6 µl of master mix, 0.5 µl ITS 4-forward primer, 0.5 µl ITS 4-reverse primer, 1 µl of template DNA, and total volume made up 20 µl with de-ionized nuclease-free water. The PCR parameters were: initial denaturation of 95 °C for 9 min, denaturation of 94 °C for 1 min, annealing of 52 °C for 1 min, an extension of 72 °C for 1 min, following 35 cycles, and final extension of 3 min period at 72 °C. The reaction mixture was held at 4 °C until the tube was removed from the machine. Amplification products were separated by electrophoresis in 2% agarose gels in 1X TAE buffer for 60 min at 90 V and visualized under gel documentation unit (AlphaImager EC).

Assay of B. bassiana UHSB-END1-colonized leaves of tomato against S. litura

In-vivo study

The effect of endophytic B. bassiana UHSB-END1 was assessed using the standard method, followed by Qayyum et al. (2015). After 40 dpi, the leaves of tomato from different treatments were sampled, and twenty 2nd instar larvae of S. litura were allowed to feed on sampled leaves of each treatment. Other 20-larvae of second instar S. litura were allowed to feed on non-colonized tomato leaves, which served as control. The food was replaced every day to ensure the freshness of samples. The observation on the morality of S. litura was recorded at 1, 3, 5, 7, 10 and 15 days after feeding. The experiment was repeated thrice and maintained at room temperature 28 ± 1 °C and RH of 70–75% and continued up to the end of the insect lifecycle.

In-planta study

Similarly, the pot culture experiment was conducted to evaluate the efficacy of endophytic B. bassiana UHSB-END1 against S. litura. About 20 larvae of second instar S. litura were released on five endophytic B. bassiana colonized 40-day-old tomato plants in each treatment. The larvae were confined for their feeding by covering larvae released tomato branch with pin holed polythene bags. The live larvae were carefully transferred to a fresh branch of the same tomato plant daily to ensure fresh food until the completion of the larval stage. The non-colonized tomato plant was also released with 20-s instar larvae of S. litura for feeding, which served as control. The observation on the morality of S. litura was recorded at 1, 3, 5, 7, 10, and 15 days after release. The experiment was repeated three times. The per cent mortality, pupation, and adult emergence of S. litura were calculated.

Confirmation of vertical transmission of B. bassiana UHSB-END1

The seed-to-seed transmission of endophytic B. bassiana UHSB-END1 was confirmed by comparing the sequences of ITS region of both mother and re-isolated fungal culture from the seedlings of next generation. The genomic DNA was isolated using CTAB method, and ITS region was amplified using PCR protocol as mentioned in Sect. 2.7.1 & 2.7.2. The similarities of ITS sequences of both mother and re-isolated fungus culture were performed using Clustal omega (https://www.ebi.ac.uk/Tools/msa/clustalol(1.81)).

Statistical analysis

The data on cumulative per cent mortality were subjected to arcsine transformation. The information on mortality of larvae was subjected to two-way ANOVA, a completely randomized design. The data on larval mortality in both in vivo and in vitro were assessed by f-test with a significance of difference at p < 0.001 in IBM Statistical Package for the Social Sciences (SPSS v.22). The data on sub-lethal effects (impact on growth and development of larvae) were subjected to one-way ANOVA, a completely randomized design. The mean data on larval mortality and sub-lethal outcomes were compared at 1 and 5% CD using Duncan’s multiple range test (DMRT) (Gomez and Gomez 1984).

Results

Fungal identification

Morphological identification

The fungal isolate collected from the tomato plant was identified as EPF, B. bassiana. The fungal colonies were white mold, dry powdery, and brownish on the reverse side on PDA medium. Conidia were hyaline, single celled, globose, and smooth walled (Fig. 1). It was identified finally by Agarkar Research Institute, National Fungal Culture Collection of India (NFCCI), Pune, Maharashtra, India. The pure culture of the indigenous isolate was also submitted (Accession no. NAIMCC-SF-0064) at the Indian Council of Agricultural Research (ICAR)—National Bureau of Agriculturally Important Microorganisms (NBAIM), Maunath Bhanjan, Uttara Pradesh, India.

Fig. 1

Morphological characters of Beauveria bassiana A, B B. bassiana cultured on PDA medium at 25 ± 2 °C for 7 days A the front side B the reverse side C Conidia were hyaline single celled, globose, and smooth walled

Molecular identification

The sequence of B. bassiana UHSB-END1 was deposited in NCBI GenBank with accession number OM131742. Blast analysis of generated fungal sequence showed 99% similarity with other isolates of B. bassiana (MK049987; LN886699; MH754663; KT183366; MN710408; MN428792; OK331343; MT635020; MN428795; MG763749). A phylogenetic tree of B. bassiana UHSB-END1 at species level was generated using Neighborhood Joining (NJ) method. The phylogenetic analysis showed that the isolate (OM131742) of the present study has a close affinity to B. bassiana with strong bootstrap support (100%) (Fig. 2).

Fig. 2

Phylogenetic tree based on Neighborhood Joining (NJ) analysis. The sequence OM131741 is the sequence generated in the present study of Beauveria bassiana UHSB-END1, and it is branched with retrieved sequences of B. bassiana

Recovery of endophytic B. bassiana UHSB-END1 from a tomato plant

Per cent colonization

The 100% colonization in leaves, stem, and root of a plant at 14, 40, 60, and 80 dpi were recorded in all the methods of inoculation of endophytic B. bassiana UHSB-END1. It was decreased to less than 80% after 120 dpi (peak reproductive stage of tomato crop) across different methods of inoculation. The rate of colonization of fungi was again increased to 100% when recovered from next generation seeds and seedlings of 25 days old (seed treatment method of inoculation). This indigenous isolate was well colonized in all plant parts during the vegetative stage (Fig. 3).

Fig. 3

Recovery of indigenous endophytic, Beauveria bassiana UHSB-END1 from tissues (leaf, stem and root) of tomato showing colony growth at different treatments: seed treatment (a), seedling root dip (b), soil drenching (c), foliar spray (d), combination of seed treatment, seedling root dip and foliar spray e at 40 dpi as compared to control (f)

Molecular confirmation

Endophytic colonization of B. bassiana UHSB-END1 was confirmed by molecular characterization after 14, 40, 60, 80, and 120 dpi and next-generation seeds and seedlings. The PCR-amplified product band of approximately 650 base pairs (bp) specific to the ITS region of tomato was observed in all the treatments (seed treatment, seedling root dip, soil drenching, foliar spray, combination) and control. In addition, all the treated plants with B. bassiana UHSB-END1 by different methods showed another amplified band around 566 bp specific to the ITS region of fungal isolate, hence confirming endophytic colonization of B. bassiana UHSB-END1 in tomato plant (Fig. 4).

Fig. 4

Confirmation of endophytic colonization of Beauveria bassiana UHSB-END1 through PCR using endophyte-specific ITS primers. a M-ladder, Lanes 1–14, 2–40, 3–60, 4–80, 5–120 dpi, 6-Control, 7—mother culture (original fungal strain), 8—reisolated fungus, 9—negative control (without DNA template); b M-ladder, Lanes 1—fresh seeds, 2–10-day dried seeds, 3–25-day-old seedlings, 4—control (fresh seeds),5—control (10-day dried seeds), 6—control (25-day-old seedlings), 7—mother culture (original fungal strain)

Assay of B. bassiana UHSB-END1-colonized leaves of tomato against S. litura

In-Vivo study

Mortality of S. litura larvae was nil after feeding endophytic B. bassiana isolate UHSB-END1-colonized tomato leaves across different methods of colonization after one day of feeding. All the colonization methods recorded more than 50% mortality of larvae after seven days of feeding. The pooled mean mortality of larvae was significantly different between the colonization methods (F_5,73 = 118.93; p < 0.0001), between the days after feeding (DAF) (F_5,73 = 313.56; p < 0.00001), and also between the interactions of colonization methods and DAF (F_24,73 = 5.22; p < 0.01). Statistically, significantly high pooled mortality of larvae was recorded in the treatment T5 (71.33%), followed by T4 (64.33%). The pooled mean mortality of larvae was significantly varied across DAF and mortality initiated at three DAF (30%) and continued up 15 DAF (73.61%). Similarly, the mean mortality of larvae was also varied across interactions of colonization methods and DAF. The significant highest mortality across different treatments was seen after 15 days of feeding the leaves (Table 1).

Table 1 In vivo feeding assay of endophytically colonized Beauveria bassiana UHSB-END1 tomato leaves against Spodoptera litura larvae

The effect of B. bassiana on growth and development of S. litura larvae by feeding colonized tomato leaves showed significantly lowest pupation (10%) in foliar spray and combination methods. There was a significant difference among all the treatments (F_5,12 = 6456.134, p < 0.00001). The larvae which didn’t enter into pupation were malformed; maximum (15%) was recorded in the soil drenching method of colonization of B. bassiana, followed by seed treatment and seedling root dip method (F_5,12 = 1166.717, p < 0.00001). The adult emergence of S. litura was nil after feeding tomato leaves colonized through combination of methods (F_5,12 = 3309.164, p < 0.00001) showing it was the most virulent to S. litura larvae (Table 2).

Table 2 Effect of endophytically colonized Beauveria bassiana UHSB-END1 in tomato plant on growth and development of Spodoptera litura under in vivo condition

In planta study

The pot culture experiment showed immediate action of B. bassiana colonized tomato plant on S. litura larvae as evidenced by 10–25% mortality of larvae after one day of feeding. No mortality of larvae was noticed in the control plant across different days after release of larvae, and they were completed normal life cycle. The pooled mean mortality of larvae was found to significantly different between the colonization methods (F_5,73 = 3633; p < 0.00001), between the days after release (DAR) (F_5,73 = 2319; p < 0.0001), and also between the interactions of colonization methods and DAR (F₂₄,₇₃ = 132; p < 0.0001). Seed treatment (T1) recorded statistically significantly higher pooled mortality (68.33%) of larvae and followed by other treatments. The pooled mean mortality of larvae was significantly varied across DAR and mortality initiated at one DAR (11.67%) and continued up 15 DAR (77.50%). Similarly, the mean mortality of larvae was also varied across interactions of colonization methods and DAR. All the colonization methods recorded more than 50% mortality of larvae after seven days of release on the plant. After 15 days of release, the colonized leaves showed maximum virulence on larvae in all the treatments. (Table 3).

Table 3 In-Planta feeding assay of endophytically colonized Beauveria bassiana UHSB-END1 in tomato plant against Spodoptera litura larvae

Significant differences between all the treatments on pupation of S. litura was documented (F_5,12 = 19,954.247, p < 0.00001). The pupation was highly reduced in treatments as compared to control. Similarly, the highest malformed pupae were noticed the treatments wherein, feeding of non-colonized tomato plant by S. litura larvae showed 5% malformed pupa (F₅,₁₂ = 357.667, p < 0.00001). The adult emergence was not noticed in the foliar spray, seedling root dip and combination of methods (F₅,₁₂ = 4582.072, p < 0.00001) (Table 4).

Table 4 Effect of endophytically colonized Beauveria bassiana UHSB-END1 in tomato plant on growth and development of Spodoptera litura under In-Planta condition

Confirmation of vertical transmission of B. bassiana UHSB-END1

The sequences of the mother culture of B. bassiana isolate UHSB-END1 (566 bp) and re-isolated fungus from next-generation seedlings were 100% identical. Therefore, the re-isolated fungal culture from seedlings was B. bassiana isolate UHSB-END1. This research finding reveals that nongrass fungal endophyte, B. bassiana UHSB-END1, can be vertically transmitted to next generation via seeds. As per the literature evidence, it is shown that vertical transmission of endophytes was proved in grass species. However, a vertical transmission was demonstrated for the first time in non-grass species in the present study.

Discussion

Identification of endophytic indigenous isolates of B. bassiana is necessary since colonization and efficacy of B. bassiana depend on isolates collected from different flora and fauna across the geographical regions (Sinno et al. 2020). Therefore, most virulent indigenous isolate of endophytic EPF, B. bassiana UHS-END1 from leaf tissues of tomato plant, was isolated and identified. This indigenous isolate was efficient in colonizing different tissues (leaf, stem, and root) of tomato plant in different methods of treatment. The rate of colonization of B. bassiana UHSB-END1 in different plant parts was equal across different treatments. It is evidenced by 100% recovery of fungus from root, stem, and leaf in all the methods of colonization so this isolate is having potential to recommend any methods for colonization of B. bassiana in tomato. This adds possible movement of fungus not only imbibition through seed but also through stomatal opening and root uptake. This is an additional benefit over earlier isolates reported wherein they required specific method (seed treatment) of colonization in tomato plant (Sanchez-Rodriguez et al. 2018). The active symbiotic association exists between endophytic fungi and tomato plant only at active plant growth period. This relationship may be hampered as the tomato plant reaches to reproductive stage or end of their lifecycle (Jia et al. 2016). This may be due to poor environmental conditions for growth of fungal endophyte inside the host. In turn, endophytes develop hidden tactics to disseminate to next generation via reproductive propagules of the plant (seeds). The grand growth period of tomato plant (vegetative phase) favors the growth and colonization of fungal endophyte transmitted from maternal seeds. Therefore, per cent colonization of this isolate in tomato fruit and their impact on S. litura larvae is novel approach to study. Beauveria bassiana UHSB-END1 colonized 100% during active growth period of plant (14, 40, 60 and 80 dpi) in different tissue (leaf, stem, and root) of tomato. The complete colonization of various tissues of the tomato plant is having more advantages in getting protection against insect pests (Wei et al. 2020). The partial or no colonization (Silva et al. 2020) and very poor colonization (Allegrucci et al. 2017) of B. bassiana in different tissues of tomato plants may reduce defensive forces against insect pests. The persistence of symbiotic relationship its trade-off between endophytic fungi and host plant at different phenological phases of plant from seedling to harvest needs to be studied for their colonization to avoid pest attack at various stages of the crop. The isolates exhibiting vertical transmission (seed to seed) behavior with symbiotic association and between the host plant and fungi throughout the cropping season gain more importance than other non-symbiotic and non-colonized isolates in pest management (Quesada-Moraga et al. 2014). Therefore, vertical transmission of this fungal isolate via seeds from one generation to another and their physic-chemical interactions needs to be understood for better exploration of the phenomenon.

Vertical transmission of endophytes is proved in most of the grass species (Gagic et al. 2018). The grass endophytes reproduce sexually by ascospores. Anamorphic stages (asexual forms) grow in the seeds of the infected host plant and eventually get transmitted to next generation of plants (Liu et al. 2017). Vertically transmitted endophytes are moved directly from the parents to their progenies (Saikkonen et al. 2002). The endophytic species belonging to the genus Neotyphodium are mostly vertically transmitted through seeds to next generation (Hartley and Gange 2009). When transmission is through the maternal seeds, they are mentioned as seed-transmitted endophytes (Schardl et al. 2013). It is also proved that the grass endophytes get horizontally transmitted between host and pass on to next generation (Wiewiora et al. 2015). Unlike in grass endophytes, no much work has been done to study vertical transmission in entomopathogenic nongrass endophytes. However, there is a proof of natural occurrence of endophytic B. bassiana get vertically transmitted in Monterey Pine, Pinus radiate (Pinaceae: Pinaceae) and positively benefits the plant by protecting them from above and below ground insects (Lefort et al. 2016). In addition, artificial inoculation of B. bassiana strain 04/01-Tip to opium poppy (Papaver somniferum L.) through seeds endophytically colonized the plant and successfully got transferred from mother plants to their progenies proving the vertical transmission (Quesada-Moraga et al. 2014). Similarly, the present research findings resulted a new insight of non-grass endophytes transmitted vertically to next generation through seeds. For the first time in non-grass crop i.e., tomato, it is demonstrated that B. bassiana isolate UHSB-END1 gets vertically transmitted to their progenies via seeds. This insightful result is helpful in understanding vertical transmission in tomato plants at different vegetative phases, and further transmission to the next generation makes them to be called as seed transmitted endophytes.

Utilization of endophytic EPF, B. bassiana UHSB-END1 can pave the way as alternative for chemical insecticides in IPM. The bioassay results both in vivo and in vitro showed biological potential of B. bassiana UHSB-END1 in bringing the mortality of S. litura larvae and impact on their normal life cycle (Fig. 5a, b and Fig. 6a, b). Very least (1%) mycosis was observed on S. litura larvae fed with B. bassiana colonized tomato plant in both in vivo and in vitro study. The mortality of larvae may be attributed combined toxic effect of bioactive secondary metabolites (insecticidal and antimicrobial) produced from both endophytic fungi and host plant rather than fungal infestation alone on the larvae (Vega 2018). Further study on chemical compounds responsible for the mortality of larvae following feeding of endophytic colonized plants is very much essential. This isolate of B. bassiana can be utilized as one of the IPM components of S. litura after proving their efficacy under field conditions. Fungal isolate alone may not yield good result under field conditions, because it has to compete for moisture, nutrient, colonization in host plant with other endophytes of fungi or bacteria. Therefore, studying of this fungal endophyte under field condition by incorporating other non-chemical approaches such as use of botanical oils and soap, pheromone traps, trap crops, adding organic manure to the soil in IPM of tomato is most encouraging to produce pesticide free tomato.

Fig. 5

Efficacy of endophytically colonized tomato plants by Beauveria bassiana UHSB-END1 on Spodoptera litura after 40 dpi a Larval mortality at different Days After Feeding (DAF) by 2nd instar larvae. Data are mean of three tests (p˂0.0001, f test) b Sub-lethal effects in in vivo assay. Mortality data are subjected to one-way ANOVA, and means are compared by DMRT (T1—seed treatment, T2—seedling root dip, T3—soil drenching, T4—foliar spray, T5—combination, T6—control)

Fig. 6

Efficacy of endophytically colonized tomato plants by Beauveria bassiana isolate UHSB-END1 on Spodoptera litura after 40 dpi a Larval mortality at different Days After Release (DAR) of 2nd S. litura larvae. Data were mean ± SE of three tests (p˂0.0001, f test) b Sub-lethal effects in in vitro assay. Mortality data are subjected to one-way ANOVA, and means are compared by DMRT. (T1—seed treatment, T2—seedling root dip, T3—soil drenching, T4—foliar spray, T5—combination, T6—control)

Recently, endophytic nature of many EPF has been explored and used extensively as pest management strategies in different cultivated crops (Barra-Bucarei et al. 2020). Likewise, Silva et al. (2020) screened three B. bassiana isolates (LEF140, LPP139 and LEF141) against South American tomato pinworm, Tuta absoluta (Gelechiidae: Lepidoptera). All three B. bassiana isolates were virulent to T. absoluta, with approximately 90% mortality over 10 days, where 30- to 40-day-old tomato plants were exposed to fungal suspensions. The spray application of endophytic myco insecticide B. bassiana on the tomato plants caused 66.7–76.6% mortality of S. littoralis (Resquín-Romero et al. 2016).

Interestingly, in addition to the larval mortality, the effects on growth and development of S. litura larvae on colonized plants were also recorded. Noticeably, increased pupal malformation in the colonized plant and the adult emergence were drastically reduced across different treatment and it was nil in combination of methods used for colonization. There are similar results reported by Qayyum et al. 2015 that endophytically colonized tomato plants by three isolates of B. bassiana (WG-14, 19, 40) inversely affected the pupation and adult emergence of Helicoverpa armigera (Noctuidae: Lepidoptera). In the same line, Akutse et al. (2013) also studied endophytically colonized plants, Vicia faba (Fabaceae: Fabales), and Phaseolus vulgaris (Fabaceae: Fabales) by Hypocrea were most prominent in reducing number of pupae and adult longevity of pea leafminer, Liriomyza huidobrensis (Agromyzidae: Diptera). Adult emergence was significantly reduced in Hypocrea (21.4%) and Beauveria (38.0%) treatments. Similarly, Akello and Sikora (2012) evaluated systemic influence of endophytic B. bassiana (seed treatment) on Acyrthosiphon pisum (Aphididae: Hemiptera) and Aphis fabae (Aphididae: Hemiptera). The colonized plants effected offspring fitness, development, and fecundity of both the species of aphids.

The present B. bassiana UHSB-END1 was isolated from leaf of tomato plant and colonized tomato plant under controlled condition. Later colonized plants were tested for their efficacy both in vivo and in vitro conditions against S. litura larvae. However, there are further confirmation of its colonization in tomato fruit and subsequent accumulation of any toxic metabolites. If there is production of toxic compounds in tomato fruit following colonization, that may be sufficient to bring the mortality of S. litura larvae or not. The produced toxins in fruit may affect human health or not by direct consumption fruit as salad. The colonization of this fungal isolate, whether it protects the vegetative stage of the crop only or needs separate management approach at reproductive stage of the crop, needs to be studied. It is also necessary to ensure safety of the isolate to other non-target organisms like predators, parasitoids, and pollinators before incorporating as one of the tools in IPM of S. litura in tomato. To conclude, this study is the first report of 100% colonization by indigenous EPF, B. bassiana UHS-END1 isolate in tomato plant. This indigenous isolate was identified based on its morphology and molecular studies. In addition, the study demonstrated the virulence of endophytically colonized tomato plant on S. litura mortality and effect on normal growth and development of insect. After ensuring the safeness of this isolate against non-target organisms and human beings, it can be one of the constitutes in sustainable cost-effective strategy for management of pests affecting tomato as one of the components in integrated pests management (IPM). Inoculation of endophytic EPF into seed/ seedling reduces environmental impacts and also easy, economical, and sustainable approach for pest management in horticulture crops which are often consumed as raw. Later, it can be expanded for the management of insect pests on other commercially cultivated vegetable crops. Although field studies are required to support the present finding, this appears to be an interesting tool that should be considered for pest biocontrol.

Conclusion

The use of endophytic EPF as a biocontrol agent is popularizing in recent days for the insect pest management in agro-ecosystem. However, identification of indigenous (region-specific) isolates gains the most important since they vary in pathogenicity and virulence against insect pest from one location to other. Therefore, this isolate was identified locally and shown good results in bringing the desirable mortality of S. litura larvae and impact on normal growth and development of larvae. Introducing the endophytic EPF into seed level will reduced the environmental pollution, and it is easy, economical, and sustainable approach for pest management. After confirming the safety to non-target organism and field studies, this isolate can be used commercially for the management of lepidopteran complex as one of the components in IPM of tomato.