Fungal strain and growth conditions
Highly virulent strain of A. solani “9013” was previously isolated by Imran et al. (2022). This fungal strain was tested for pathogenicity and found highly virulent on tomato plants causing early blight disease. The strain was collected from the fungal stock culture of the laboratory. Strain was sub-cultured on PDA medium plates incubated at 27 °C for 7 days. Culture was maintained at 4 °C for further use.
Isolation and field-testing of Trichoderma as potential bioagents
For the isolation of naturally existing potential bioagents against fungal pathogens, soil samples were collected from the rhizosphere of healthy tomato plants. Then, 5 ml of sterilized double distilled water was added to each 2 g of soil sample, followed by mixing by vortexing. Dilutions 10–4, 10–5, 10–6, 10–7, 10–8 and 10–9 were prepared from supernatant from each sample (Bin et al. 2020) and inoculated on rose Bengal (RB) medium plates and incubated at 27 °C for 48 h. Germinating fungal colonies were further purified by single spore transfer (Dou et al. 2019). Colonies derived from single spores were further transferred to new PDA plates, and 3-mm-diameter mycelial disks from 3-day-old culture were transferred to PDA glass tubes. Fungal cultures were maintained in glycerol tubes and stored at 4 °C for further use.
In vitro screening and selection of antagonists
All isolates were tested for their antagonistic potential against the highly virulent A. solani strain. Antagonistic activity was determined on PDA plates. Bioagent isolates grown on PDA for 3 days were used to determine the antagonistic effect by dual culture assay against A. solani strain. Briefly, 5-mm-diameter mycelial disk from pathogen and identical diameter disks from each bioagent (priorly grown on PDA) were placed face to face on new PDA plates at equal distance from edges PDA plates containing pathogen disks were used as controls. Three replicates (each comprising 5 plates) were prepared for each potential bioagent isolate, and plates were incubated at 27 °C for 7 days. At this stage, in control plates the selected highly virulent A. solani strain would typically cover the whole plate. Diameters of pathogen isolate colonies on test plates were measured, and mean values were calculated to quantify the inhibitory effect of each potential bioagent isolate. The experiment was repeated twice. Based on pathogen colony mean diameters, bioagents showing best antagonistic activity were selected for further experiments.
Morphological and molecular identification of bioagents
All potential bioagent isolates were classified morphologically based on colony color, length and width of conidia, hyphae length, and shape and diameter of conidia (Kumar et al. 2012). Selected bioagent isolates were classified by amplification and Sanger sequencing of internal transcribed spacer (ITS) regions using generic primer pair ITS5 (5′GGAAGTAAAAGTCGTAACAAGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (White et al. 1990). DNA of the selected isolates was extracted by CTAB as of pathogen. PCR was performed in a thermal cycler with the final volume 50 µl of reaction mixture with this primer pair as described above for pathogen isolates. PCR was performed as following: initial denaturation at 94 °C for 3 min followed by 30 cycles, denaturation at 94 °C for 1 min, 56 °C for 30 s, 72 °C for 30 s, and final incubation at 72 °C for 10 min. Reaction products were cooled to 4 °C for 10 min. PCR products were then separated on 2% agarose gel in 1× Tris–acetate (TAE) buffer and stained with 0.5 μg ethidium bromide solution for 10 min, and an Alpha Imager™ gel imager system was used to record fluorescence images. PCR products were submitted to Sanger sequencing by Macrogen Company, Seoul, South Korea. Obtained sequences of PCR products were compared ITS sequences available in public domain of National Center for Biotechnology Information (NCBI) library using Basic Local Alignment Search Tool (BLAST). Respective potential bioagent isolates were identified on the basis of their similarity to published reference sequences, and obtained new ITS sequences were submitted to NCBI under specific accession numbers. Phylogenetic trees were constructed from ITS1 sequence data with the help of the neighbor joining algorithm in MEGA 6X software package (Tamura et al. 2013).
Establishment of conventional control of A. solani with chemical fungicides
For in vitro mycelial inhibition virulent A. solani strain, different concentrations of a commercial fungicide Mancozeb (90% WP) [ethylenebisdicarbamates] were used that is recommended to control early blight disease in local commercial farming. Stock solution (0.5 g/L) of the fungicide was prepared in sterile double distilled water that was further used to prepare the tested concentrations, viz. 50, 100, 200 and 400 ppm. These concentrations were dissolved in PDA, and 5-mm mycelial disks from 7-day-old A. solani culture were placed face-down in the middle of fungicide-amended plates. PDA plate lacking fungicide but the pathogen was subjected as control. Plates were incubated at 27 °C for 7 days, and colony diameter was measured. Percent mycelial growth inhibition was calculated according to Bekker et al. (2006) as: Percent inhibition = [(C − T)/C]*100, where, C representing colony diameter (mm) observed in controls, and T colony diameter (mm) observed in treatments. Experiments were performed in triplicates, with each replicate consisting of five plates. The experiment was repeated twice for the consistency of results.
Effect of potential Trchicoderma bioagents early blight disease severity
Under greenhouse condition
To test the efficacy of selected potential Trichoderma against early blight disease under greenhouse conditions relevant to horticultural praxis, experiments were conducted (in 2020) in greenhouses of the Department of Arid Land Agriculture, King Abdulaziz University Jeddah, Saudi Arabia, with tomato variety “Doucen.” Briefly, tomato seeds were germinated and seedlings were grown in 18 cm plastic pots containing peat moss (1:3). At 3–4 leaf stage, seedlings were singled out to new pots. Selected potential Trichoderma isolates to be tested were grown on PDA for 5 days at 27 °C. Growing mycelia were scraped with a sterilized scraper and crushed in 20 ml of sterilized double distilled water, and resulting debris was filtered through 3 layers of cheese cloth to remove fragmented mycelium from spores. Twenty-days-old plants were sprayed with the resulting spore suspension (10 mL/plant) with a compression sprayer (Blue Stallion Co., Ltd, India) (Singh et al. 2019). Spore suspension of highly virulent A. solani strain priorly grown on PDA was prepared identical methods used for the preparation of Trichoderma suspension. Two days of spraying Trichoderma, pathogen spore suspension (104 spores mL−1 adjusted by hemo-cytometer) 5 mL/plant was sprayed with a compression sprayer (Blue Stallion Co., Ltd, India). Plants sprayed first with potential bio-agent, but then only with sterilized distilled water at the time of pathogen spraying served as “healthy” control. In contrast, “diseased” control plants were sprayed only with pathogen. Mancozeb fungicide as “conventional treatment” was sprayed at a concentration of 50 mg L−1 (25 mL per plant) was sprayed at the same time of pathogen inoculation (Gondal et al. 2012). After pathogen inoculation, plants were covered with sterile polythene bags for 3 days. Standard agronomic practices were carried out in greenhouse, and experiment was performed with 4 replicates for each treatment, with 3 plants for each replicate. The experiment was performed twice and disease severity was estimated with a grade 0–5 disease rating scale as: 0 = leaves free from leaf spots; 1 = 0–5% of leaf area infected; 2 = 6–20% of leaf area infected; 3 = 21–40% leaf area infected; 4 = 41–70% leaf area infected; 5 = more than 70% of leaf area infected (Gondal et al. 2012).
Prior to disease severity, plant height was calculated, and after this, fresh and dry weight of roots and shoots were measured to determine the dry weight; plants were placed in moisture dryer chamber at 60 °C for 3 days. Means of parameters were calculated and compared for different treatments.
Open field trials
The study was conducted for 2 consecutive seasons early (season I: Jan-Mar) and late (season II: Sep-Dec) 2020 to monitor the efficacy of potential Trichoderma under open field conditions. In season I, seedlings of the variety “Doucen” were grown in plastic seedling trays (50 holes) containing peat moss (1:3). At 3–4 leaf stage, tomato seedlings were transplanted to the field, maintaining 60 cm distance between rows and 45 cm within plants in a row. Suspensions of fungal Trichoderma were prepared as described above for greenhouse inoculation. Two weeks after transplanting, Trichoderma suspensions were applied as foliar spray (100 mL per plant) on tomato plants with a garden sprayer (Skybird Agro Ind. Amritsar, Punjab, India), while Mancozeb fungicide as 50 mg L−1 was sprayed (50 mL/plant) (Majumder et al. 2020) with hand sprayer (Taizhou Jiolong Machinery Co., Ltd, Zhejiang, China). Control plants were sprayed with sterile distilled water only. All treatments were applied in the evening hours, and plants were left for natural pathogen infection under open field conditions. After applying treatments, weather conditions were monitored to exclude washout of pesticides as well as Trichoderma suspensions due to rain. Standard agronomic practices were carried out in field. Disease severity was recorded based on a grade 0–9 disease rating scale as: 0 = no infection, 1 = 0–10%, 2 = 10–20%, 3 = 20–30%, 4 = 30–40%, 5 = 40–50%, 6 = 50–60%, 7 = 60–70%, 8 = 70–80%, 9 = 80–90% or more leaf area infected (Singh et al. 2014) and percent disease severity was calculated by above mentioned formula. Ripened tomato fruits were harvested regularly from all replicates in all treatments and fruit yield per treatment was calculated.
The experiments were conducted under complete randomized block design with 4 replicates, each carrying 4 plants. All recommended agronomic practices were adapted in experimental zone. Plants were randomly sprayed for each treatment. Experiment with same parameters was repeated in season II. Percent disease severity and fruit yield were calculated and compared among treatments.
Data analysis
All in vitro experiments were conducted in triplicates, while field experiment was conducted with 4 replicates. Field experiments were performed in a complete randomized design, and all collected data were analyzed by using statistix 8.1 (Analytical software, statistix; Tallahassee, FL, USA, 1985–2003) software. The data for disease severity were transformed into arcsine values, and a one-way analysis of variance (ANOVA) was performed. Means of replicates in all treatments were compared using Fisher’s least significant difference test at p = 0.05 (Steel et al. 1996).
