Isolation of Fusarium wilt pathogen
In order to isolate Fusarium wilt pathogen, the root and stem tissues of wilted tomato plant samples obtained from a farmer's field were washed under tap water to remove the soil particles. The infected tissues were cut into 5–10 mm long pieces, followed by surface sterilization for 1 to 2 min in 2% sodium hypochlorite solution and washed twice in sterile distilled water. These surface sterilized tissues were placed on potato dextrose agar (PDA) plates and incubated at 28 ± 2 °C for 7–10 days. The fungal culture was purified using Rangaswami's (2005) hyphal tip cut technique. Potato dextrose agar (PDA) slants were used to maintain the pure cultures.
Pathogenicity test and inoculum preparation
Pathogenicity test was performed using Devi and Srinivas (2012) root dip technique. Three-week-old tomato seedlings were chosen and 2–4 cm root tip were cut and immersed in one-week-old FOL conidial suspension of 106 spores/ml for 30 min. The inoculated seedlings were transplanted into a disposable polyvinyl chloride container containing 1:1 soil and sand mixture. The plant showing complete wilting symptoms was reisolated according to Koch's postulates, and pathogenicity was therefore verified (Ignjatov et al. 2012). Nirmaladevi et al. (2016) reported cultural and morphological characteristics that were further utilized to validate the pathogen's identity in this study. Conidial suspension of FOL was made from a 7-day-old broth culture grown in potato dextrose broth. Each plant in both pots and field trials was inoculated with 10 ml of FOL conidial suspension having 107 spores/ml 30 days after transplanting of tomato seedlings.
Collection of root samples and isolation of endophytic Bacillus
Root samples of healthy tomato plants were collected from South West Garo hills, West Garo hills, West Jaintia hills, East Jaintia hills and East Khasi hills districts of Meghalaya, India. With slight modifications, the technique described by Zinniel et al. (2002) was used to isolate endophytic Bacillus. After washing in running tap water, healthy root surfaces were sterilized in 70% ethanol for 1 min and then sterilized in 2% sodium hypochlorite for 3 min. It was then sterilized in 70% ethanol for 30 s before being rinsed 4–5 times in sterile double distilled water. Roots were cut into tiny pieces and macerated separately with a sterile pestle and mortar in phosphate buffer at pH 7.2. To eliminate additional undesired bacteria, 1.5 ml of the whole extract was suspended in micro centrifuge tubes and given heat shock treatment at 80 °C for 5 min. The tissue extracts were then prepared for serial dilution in sterile saline up to 10–5 and 0.1 ml of each dilution of the tissue extract was plated with nutrient agar medium by spread plate method. These plates were then incubated at 28 ± 1 °C for 24 h. Purified bacterial isolates were preserved at 80 °C in 50% glycerol for subsequent investigation.
In vitro antagonistic assay
The antagonistic potential of Bacillus isolates against F. oxysporum f. sp. lycopersici (FOL) was assessed using the dual culture method of Ganesan and Gnanamanickam (1987). Seven-day-old culture of FOL disc of 5 mm was placed at the centre of a fresh PDA plate. Then, 24-h-old each bacterial strain was streaked parallel on both sides of the fungal disc 25 mm away from the disc. Plates without bacterial streak served as control. Three replications were maintained. The plates were kept for incubation at 28 ± 1 °C for 7 days. After control plates reached 90 mm diameter, the growth measurement of the pathogen was recorded and per cent mycelium inhibition over control was worked out by using the following formula:
$${\text{Inhibition}}\,(\% ) = \frac{C - T}{C} \times 100$$
where ‘C’ is the maximum growth of the fungal mycelium under control condition and ‘T’ is the fungal mycelium growth in treatment.
Molecular identification of Bacillus isolates
Molecular identification was carried out only for those endophytic Bacillus isolates that were found most effective in dual culture method. Himedia Bacterial Genomic DNA Purification Kit (MB505-50PR) was used to extract the genomic DNA from selected Bacillus isolates. 16S rRNA intervening sequence-specific BCF1 (CGGGAGGCAGCAGTAGGGAAT) and BCR2 (CTCCCCAGGCGGAG TGCTTAAT) primers were used to obtain an amplicon size of 546 bp to confirm strains as Bacillus sp. (Cano et al. 1994). PCRs were carried out in 20 μl reaction mixture containing 5 μl of template DNA samples, 2 μl 10X buffer, 1.6 dNTP mixture, 0.5 μl MgCl2, 1 μl forward primer, 1 μl reverse primer, 0.1 μl Taq DNA polymerase and 8.8 µl nuclease free water were amplified on Gradient Master Cycler 5331 using the PCR conditions 1 min at 94 °C, 1 min at 58 °C and 1 min at 72 °C. The overall number of cycles was 40, with the last extension lasting 10 min at 72 °C. 5 µl of amplified 16s rRNA gene product was separated on a 1% (w/v) agarose gel electrophoresis at 50 V for 45 min and visualized and images were captured using gel documentation system (BioRad, CA, USA). The purified PCR products of microbial gene fragments were sent to Agrigenome Labs Pvt. Ltd. in Hyderabad, India, for sequencing. BLAST searches (http://blast.ncbi.nlm.nih.gov/Blast.cgi) were used to compare the sequences to the NCBI database. The sequences were aligned with Clustal W, and a phylogenetic tree was constructed from the evolutionary distances by the neighbour-joining method with the software MEGA7 (Nikunjkumar 2012).
Detection of antifungal antibiotic synthesis genes from selected Bacillus endophytes
The presence of antifungal biosynthesis genes for the Bacillus isolates found effective in dual culture that specifies the production of antibiotics, viz. iturin A, surfactin and bacillomycin D were screened by using gene-specific primers in PCR-based method. The PCR amplification of iturin A gene (647 bp) [primer ITUD1F (F-5′GATGCGATCTCCTTGGATGT3′) and ITUD1R (R-5′ATCGTCATGTGCTGCTTGAG3′], surfactin gene (441 bp) [primers SUR3F (F-5′ACAGTATGGAGGCATGGTC3′) and SUR3R (R-5′TTCCGCCACTTTTTCAGTTT3′)] and bacillomycin D gene (875 bp) [primer BACC1F (F-5′GAAGGACACGGCAGAGAGAGTC3′) and BACC1R (R-5′CGCTGATGACTGTTCATGCT3′)] (Ramarathnam 2007) were carried out in a 20 μl reaction volume containing 5 µl template DNA, 2 µl 10X buffer, 0.5 µl MgCl2, 1.6 µl dNTPs, 1 µl forward Primers, 1 µl reverse primer, 0.1 µl Taq DNA Polymerase and 8.8 µl Nuclease free water. Each amplification product was separated on a 1% (w/v) agarose gel electrophoresis. Gels images were captured using gel documentation system (BioRad, CA, USA). Following PCR conditioning were used to amplify the genes: iturin A gene—initial denaturation at 94 °C for 3 min, 40 cycles consisting of denaturation of 94 °C for 1 min, annealing for 1 min at 60 °C, 72 °C for 1 min off primer extension and final extension 72 °C for 10 min; surfactin—Initial denaturation at 94 °C for 3 min, 40 cycles consisting of 94 °C for 1 min, 57 °C for 1 min, 72 °C for 1 min and final extension 72 °C for 10 min; and bacillomycin D—total of 35 cycles consisting initial denaturation at 94 °C for 3 min, denaturation at 94 °C for 1 min, 60 °C for 30 s, 72 °C for 1 min and final extension 72 °C for 6 min.
Screening for hydrolytic enzyme production
Screening of the selected potential Bacillus endophytes for production of hydrolytic enzymes like alpha amylase, cellulase, lipase, protease and pectinase were done by the methods described by Cappuccino and Sherman (1992). For cellulase production, Bacillus isolates were spot inoculated on congo red cellulase agar plates at 28 ± 2 °C for 48 h. The presence of clear zones around the bacterial colonies was taken as positive. Tributyrin agar plates were streaked with Bacillus isolates and kept at 28 °C for 24–48 h and the appearance of clear zone around the bacterial growth was taken as positive result for lipase production. For protease and pectinase production, one loopful of the bacterial cell suspension was streaked on skim milk agar and pectin agar plate (Mohandas et al. 2018), respectively. After 48 h incubation at 28 °C, appearance of clear zone around the bacterial streak was taken as positive for protease production. For pectinase production, Gram's iodine solution was poured onto pectin agar after 48 h of incubation, and the zone of clearing was examined against a dark blue background.
Screening for antimicrobial secondary metabolites production
Antimicrobial secondary metabolite production such as HCN and siderophore production was screened for the effective Bacillus isolates. The test endophytic Bacillus isolates were screened for hydrogen cyanide production, following the method described by Lorck (1948). The appearance of orange or red colour on Whatman number 1 filter paper indicated the production of hydrogen cyanide. For siderophore production, Universal Chrome Azurol S (CAS) agar medium as described by Schwyn and Neilands (1987) was used to check siderophore producing ability of Bacillus isolates. After incubation for 5–7 days at 28 °C, the presence of an orange zone surrounding the bacterial growth indicated a positive outcome.
Screening for plant growth promotion (PGP) activity
The growth‐promoting activities of test Bacillus isolates were assessed by following the standard procedure for determining the phosphate solubilization on Pikovskaya’s agar medium (Pikovskaya 1948), zinc solubilization on Tris-minimal agar medium supplemented with D-glucose and different insoluble zinc compounds, viz. zinc sulphate (ZnSO4), zinc oxide (ZnO), zinc chloride (ZnCl2) and zinc carbonate (ZnCO3) (Sharma et al. 2011), potassium solubilization on Aleksandrov agar medium (Aleksandrov et al. 1967) and ammonia production (Cappuccino and Sherman 1992). On each individual test media, colour changes and a noticeable halo zone encircling the bacterial colony validated the results of positive plant growth-promoting (PGP) qualities.
Isolation and identification of arbuscular mycorrhizal spores
Wet sieving and decanting method of Gerdemann and Nicolson (1963) was followed to isolates arbuscular mycorrhizal spores from rhizospheric soils of tomato grown in Meghalaya where 50 g rhizosphere soil mixed in one litre water was passed through sieves arranged in a descending order from 500 μm, 212 μm, 106 μm, 53 μm to 38 μm sizes. Spores collected from the sieves were stored in vials containing 2 ml sterile water at 4 °C. The dominant AMF spores were identified using morphological descriptions from the International Culture Collection of Arbuscular Mycorrhizal Fungi (INVAM) website (http://www.invam.caf.wvu.edu), Schenck and Perez (1990) and the AMF phylogeny (www.amf-phylogeny.com). The spores were also sent to National Centre of Fungal Taxonomy (NCFT), New Delhi, for AMF species identification. AMF spores were purified using a technique outlined in INVAM (http://invam.caf.wvu.edu) for single species isolation.
Experimental design
Two AMF species dominating the rhizosphere soils of tomato and 2 endophytic Bacillus strains having good PGP and antagonistic activities were evaluated against FOL under pot and field conditions. All the possible treatment combinations were made among the 4 bioinoculants. One negative control (without pathogen), positive control (only pathogen inoculated) and a check fungicide carbendazim were also taken. The pot experiment was conducted at the CPGS-AS campus, CAU, Umiam, Meghalaya, whereas the field experiment was conducted in the farmer’s field located at Umiet village, Umroi, Ri-Bhoi District, Meghalaya, which was situated between 91°57′07.2″E longitude and 25°42′33.4″N latitude. A total of 18 treatments were allocated with 3 replications each for both pot and field experiments. ‘Rocky’ tomato variety was used for the experiments. The plot size of 2 × 2 m2 with a spacing of 50 × 50 cm was maintained for the field experiment set in a randomized block design (RBD). The pot experiment was conducted by completely randomized block design (CRD). The crop was sown in the 1st week of January and transplanted on first week of February 2020 in both the field and pot trials.
Sterilization of the soil and pot filling
For both the pot and field trials, tomato seeds variety ‘Rocky’ were sown in plastic trays filled with sterilized sand: soil mixture (1:2 v/v) and grown for 30 days. Soil and sand in the ratio 3:1 were sterilized in autoclave 3 times at 15lbs/inch2 for one hour and filled in pots of 30 cm diameter for pot experiment.
Preparation and inoculation of bioinoculants
AMF inocula were mass multiplied using the method of Sharma (2016). 2.5 kg soil mixture containing soil, sand and farm yard manure (FYM) at the ratio of 1:1:1 filled in polypropylene bags was sterilized thrice at 15lbs/inch2 for one hour. AMF inocula as soil, sand and chopped roots were put in upper 3–5 cm layer of plastic pots (3 kg soil capacity) containing sterilized sand: soil: FYM mixture. Following that, surface sterilized maize (Zea mays) seeds were sown in these pots. For 3 to 4 months, the plant was allowed to grow in the containers. The maize roots were chopped and mixed with the potting mixture which is used as an inoculum. The mycorrhizal inocula were separately placed below the seedling by the layering method as described by Menge et al. (1977) @ 200 g soil inoculum (5–6 AM spores/ g soil) per pot and per plant (Kuppusamy and Kumutha, 2012) by spreading the inoculum as a layer at a depth of 3–5 cm in the planting holes of seedlings during the time of transplanting of 30-day-old tomato seedlings.
The two endophytic Bacillus strains were cultured separately in Luria broth and then incubated in a rotary shaker of 150 rpm and 28 ± 1 °C. The bacterial suspensions were adjusted to 1 × 108 CFU/ml after 48 h of incubation. 10 ml/plant (1 × 108 CFU/ml) of separate Bacillus suspensions and microbial consortium (MC) was used for root dip treatment for 30 min and soil treatment during transplanting. The treatments also included root dip treatment of tomato seedlings with carbendazim @ 0.2% for 10 min before transplanting. Seedlings without any treatment served as negative controls and only pathogen inoculated seedlings served as positive control.
Observations
Disease severity
Disease incidence was measured after 60 and 80 DAT. The 0–4 scale described by Song et al. (2004) was used to record the disease severity. The severity of the disease was graded on a scale of 0 to 4 as given below:
Scale | Intensity |
|---|
0 | : no infection |
1 | : A slight infection, which is about 25% of full scale, one or two leaves become yellow |
2 | : Moderate infection, two or three leaves become yellow, 50% of the leaves become wilted |
3 | : Extensive infection, all plant leaves became yellow, 75% of the leaves become wilted, and growth is inhibited |
4 | : Complete infection, the whole plant leaves become yellow,100% of the leaves become wilted, and the plants die |
Percentage of disease severity was calculated using the formula given by Song et al. (2004):
$$= \frac{{\sum {{\text{Scale}} \times {\text{Number}}\,{\text{of}}\,{\text{plants}}} }}{{{\text{Highest}}\,{\text{scale}} \times {\text{Total}}\,{\text{number}}\,{\text{of}}\,{\text{plants}}}} \times 100.$$
Disease reduction over positive control
It was calculated by the following formula:
$$\% \,{\text{disease}}\,{\text{reduction}} = \frac{C - T}{C} \times 100$$
where C = % disease severity in positive control and T = % disease severity in treated plants.
Plant parameters
During the experiment, growth parameters such as number of leaves, plant height (cm) at 30 and 60 Days after transplanting (DAT), root fresh weight (g), shoot fresh weight (g), number of fruits per plant and yield of tomato per plant (kg) were recorded.
Statistical analysis
Dual culture assay was designed in completely randomized design (CRD) with 3 replications for each treatment, and the data were analysed using one-way analysis of variance (ANOVA). The field and pot experiments data were statistically analysed by one-way analysis of variance (ANOVA). Disease severity and disease reduction (%) over positive control in field experiment were transformed using arc sine transformation. If there are significant differences among treatments, it was compared by using Duncan’s multiple range test (DMRT) at p = 0.05 significance level.
