Skip to main content

Table 1 List of used primers in the study

From: Effect of honeybee venom and Egyptian propolis on the honeybee (Apis mellifera L.) health in vivo

The primer Sequences (5'-3') Position on the genome Accession number References
Actin (Fwd.) TGCCAACACTGTCCTTTCTG 208 AB023025 Cunha et al. (2005)
Actin (Rev.) AGAATTGACCCACCAATCCA 344   
Vitellogenin (Fwd.) TTCTGATAAAGGCGTTGCT 173 NM_001011578 Corona et al. (2007)
Vitellogenin (Rev.) GTTTTCTCCATCTTTGCTAAAGTCA 914   
JH esterase (Fwd.) GTTTACGTGCCGGCAGATAG 511 NM_001011563.1 Bomtorin et al. (2014)
JH esterase (Rev.) TTCTGAAACCCATCGCAACG 737   
Abaecin (Fwd.) CAG CAT TCG CAT ACG TAC CA 6 AF442147.1 Schlüns and Crozier (2007)
Abaecin (Rev.) GAC CAG GAA ACG TTG GAA AC 77   
Defensin (Fwd.) TGT CGG CCT TCT CTT CAT GG 88 NM001011616.2 Schlüns and Crozier (2007)
Defensin (Rev.) TGA CCT CCA GCT TTA CCC AAA 288   
Hymenoptaecin (Fwd.) ATT CAT GGC ATC GTG AAC AA 2982 XM003251652.4 Schlüns and Crozier (2007)
Hymenoptaecin (Rev.) CTG TGG TGG AGT TGT TGG TG 3122