Skip to main content

Table 1 List of used primers in the study

From: Effect of honeybee venom and Egyptian propolis on the honeybee (Apis mellifera L.) health in vivo

The primer

Sequences (5'-3')

Position on the genome

Accession number

References

Actin (Fwd.)

TGCCAACACTGTCCTTTCTG

208

AB023025

Cunha et al. (2005)

Actin (Rev.)

AGAATTGACCCACCAATCCA

344

  

Vitellogenin (Fwd.)

TTCTGATAAAGGCGTTGCT

173

NM_001011578

Corona et al. (2007)

Vitellogenin (Rev.)

GTTTTCTCCATCTTTGCTAAAGTCA

914

  

JH esterase (Fwd.)

GTTTACGTGCCGGCAGATAG

511

NM_001011563.1

Bomtorin et al. (2014)

JH esterase (Rev.)

TTCTGAAACCCATCGCAACG

737

  

Abaecin (Fwd.)

CAG CAT TCG CAT ACG TAC CA

6

AF442147.1

Schlüns and Crozier (2007)

Abaecin (Rev.)

GAC CAG GAA ACG TTG GAA AC

77

  

Defensin (Fwd.)

TGT CGG CCT TCT CTT CAT GG

88

NM001011616.2

Schlüns and Crozier (2007)

Defensin (Rev.)

TGA CCT CCA GCT TTA CCC AAA

288

  

Hymenoptaecin (Fwd.)

ATT CAT GGC ATC GTG AAC AA

2982

XM003251652.4

Schlüns and Crozier (2007)

Hymenoptaecin (Rev.)

CTG TGG TGG AGT TGT TGG TG

3122