Skip to main content

Table 1 Primers used for toxin gene sequencing

From: Isolation and determination of bacterial microbiota of Varroa destructor and isolation of Lysinibacillus sp. from it

Toxin gene primers Primer sequence (5′ → 3′)
Mtx1F CAAGCTGCTTCACTTACATG
Mtx1R GTCCAGTTACATCTTGAGCC
Mtx2F GGAGACTAATTGAATTTTCGGTTTCC
Mtx2R GCGATGCTGGGCTATGTTCGTTGTTA