Skip to main content

Table 2 Phytophthora genus and species specific primers sequence

From: Evaluation of the bioformulation of potent native strains of Trichoderma spp. against the foot rot/gummosis of Kinnow mandarin

Primer name Sequence (5′-3′) Direction Fragment size (bp) Specificity
Ph2 ATACTGTGGGGACGAAAGTC Forward 700 At genus level
ITS4 TCCTCCGCTTATTGATATGC Reverse
Pn5B GAACAATGCAACTTATTGGACGTTT Forward 120 At species level
Pn6 AACCGAAGCTGCCACCCTAC Reverse