Skip to main content

Table 1 Characteristics of primers for screening of cry-type and 16S-ITS rDNA region genes

From: Isolation of Iranian Bacillus thuringiensis strains and characterization of lepidopteran-active cry genes

Primer name Melting temperature (°C) Sequence
(5' → 3')
Reference
16S ITS rDNA(F) 60 AGAGTTTGATCCTGGCTCAG Yılmaz et al., (2012)
16S ITS rDNA(R) 53 CAAGGCATCCACCGT  
Spcry1Aa (F) 54 TTCCCTTTATTTGGGAATGC Seifinejad et al. (2008)
UNcry1 (R) 51 MDATYTCTAKRTCTTGACTA  
Lep2 (F) 58 CCGAGAAAGTCAAACATGCG Boukedi et al. (2016)
Lep2 (R) 58 TACATGCCCTTTCACGTTCC  
St2C (F) 56 GGGACATTCCTTCGTTTCG BenFarhat-Touzri et al. (2016)
St2Cinv(R) 54 GGTGTTCCAGATCTTTGAAC  
St1D (F) 49 ATGGAAATAAATAATCAAAACC BenFarhat-Touzri et al. (2016)
St1Dinv (R) 51 ACTAGATTGGATACCTGATC  
UNcry2 (F) 55 CGGATAAAATAATCTGGGAAATAGT Salehi Jouzani et al. (2008)
SPcry2Aa (R) 57 GAGATTAGTCGCCCCTATGAG  
UNcry2 (F) 55 CGGATAAAATAATCTGGGAAATAGT Salehi Jouzani et al. (2008)
SPcry2Ab (R) 65 TGGCGTTAACAATGGGGGGAGAAAT