Skip to main content

Table 2 PCR primer sequences

From: Alterations in the expression of certain midgut genes of Spodoptera littoralis (Boisd.) (Lepidoptera: Noctuidae) larvae and midgut histopathology in response to Bacillus thuringiensis Cry1C toxin

Gene

Forward (5-3)

Reverse (5-3)

ALP

CCACGACAACTTCGTAGAGC

AGTGATCCGCTGTAACCACA

APN

CCGGCTCCTACACCATTACT

GTAGCGTAGTACCTGCGAGT

CYP

ACTGCGGAGACAGTTTCCAT

AGTGTGTAACTGGTCGCTGA

Try

CAACTACTGGCCTGGTGACA

GCGGGTAGCGTAGTTGTTTC

Cad

ACCAGCTGAGGATCGAGAAG

CAATGGCCACGTCATCTACG

28S rRNA

GAGAGTGCAGCCCTAAGTGG

GGTTTACCCCTGAACGGTTT

  1. Cad cadherin, ALP alkaline phosphatase, APN aminopeptidase N, Try trypsin, CYP cytochrome P450