Skip to main content

Table 2 PCR primer sequences

From: Alterations in the expression of certain midgut genes of Spodoptera littoralis (Boisd.) (Lepidoptera: Noctuidae) larvae and midgut histopathology in response to Bacillus thuringiensis Cry1C toxin

Gene Forward (5-3) Reverse (5-3)
ALP CCACGACAACTTCGTAGAGC AGTGATCCGCTGTAACCACA
APN CCGGCTCCTACACCATTACT GTAGCGTAGTACCTGCGAGT
CYP ACTGCGGAGACAGTTTCCAT AGTGTGTAACTGGTCGCTGA
Try CAACTACTGGCCTGGTGACA GCGGGTAGCGTAGTTGTTTC
Cad ACCAGCTGAGGATCGAGAAG CAATGGCCACGTCATCTACG
28S rRNA GAGAGTGCAGCCCTAAGTGG GGTTTACCCCTGAACGGTTT
  1. Cad cadherin, ALP alkaline phosphatase, APN aminopeptidase N, Try trypsin, CYP cytochrome P450