Skip to main content

Table 1 Sequences of PCR and qPCR primers used in study of Helicoverpa armigera

From: Molecular identification, characterization, and expression analysis of a novel trypsin inhibitor-like cysteine-rich peptide from the cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae)

Gene nameSequence
HaTIL2-F5′-GGATCCATGTTTAAGTCGTCTTTATTGATTTTGAG-3′
HaTIL2-R5′GGTACCTTAATGATGATGATGATGATGCTGGGGGCAGTCATCAATAGCTATGCATTCTCC-3′
HaTIL2-qF5′-GTAGTGCTTGTCCAACTA-3′
HaTIL2-qR5′-CTCCATCGTCATTTCTTG-3′
RPL28-qF5′-CATCTGAACTGGATGATC-3′
RPL28-qR5′-GTACACTACTGTGAAACC-3′