Skip to main content

Table 1 Characteristics of universal primers for cry1, cry2, cry3, cry4, and cry7, 8 group genes

From: Isolation and identification of Bacillus thuringiensis strains native of the Eastern Province of Saudi Arabia

Primer pair Sequence of primer Gene recognized Expected size (bp)
Un1(d)
Un1(r)
5′CATGATTCATGCGGCAGATAAAC-3′
5′-TTGTGACACTTCTGCTTCCCATT-3′
cry1 274
277
Un2(d)
Un2(r)
5′-GTTATTCTTAATGCAGATGAATGGG-3′
5′-CGGATAAAATAATCTGGGAAATAGT-3′
cry2 689
701
Un3(d)
Un3(r),
5′CGTTATCGCAGAGAGATGACATTAAC3′
5′-CATCTGTTGTTTCTGGAGGCAAT-3′
cry3 589
595
604
Un4(d)
Un4(r)
5′-GCATATGATGTAGCGAAACAAGCC3′
5′-GCGTGACATACCCATTTCCAGGTCC-3′
cry4 439
Un7,8(d)
Un7,8(r)
5′AAGCAGTGAATGCCTTGTTTAC-3′
5′-CTTCTAAACCTTGACTACTT-3′
cry7 and cry8 420
423