Skip to main content

Table 1 List of oligonucleotide primers used for the characterization of Sclerotium rolfsii at molecular level

From: Use of Neem leaves as soil amendment for the control of collar rot disease of chickpea

No. Primer name 5′ to 3′ sequence Annealing temperature
1 ITS 1 forward TCCGTAGGTGAACCTGCGG 60 °C
2 ITS 4 reverse TCCTCCGCTTATTGATATGC
3 β-tubulin forward GGTAACCAAATCGGTGCTGCTTTC 62 °C
4 β-tubulin reverse ACCCTCAGTGTAGTGACCCTTGGC