Skip to main content

Table 1 Primers used in this study

From: Molecular characterization and virulence of fungal isolates against the bean flower thrips, Megalurothrips usitatus Bagnall (Thysanoptera: Thripidae)

Sr No. Genes Primer Primer Sequence
1 ITS ITS4F TCCTCCGCTTATTGATATGC
ITS5R GGAAGTAAAAGTCGTAACAAGG
  1. ITS internal transcribed spacer