Skip to main content

Table 1 Sequence of primers used in qRT-PCR analysis

From: Antifungal activity and resistance induction against Sclerotium cepivorum by plant growth-promoting fungi in onion plants

PrimeDirectionSequence 5′-3′
PR1ForwardTTCTTCCCTCGAAAGCTCAA
ReverseCGCTACCCCAGGCTAAGTTT
PR2ForwardTCCGGGGTATGTTATGGAAGA
ReverseGGCCATCCACTCTCAGACACA
EF1αForwardATTGGAAACGGATATGCTCCA
ReverseTCCTTACCTGAACGCCTGTCA