Skip to main content

Table 1 Forward and reverse primers of Cry1Ac genes and Cry 3A promoter region

From: Genetic improvement of Bacillus thuringiensis against the cotton bollworm, Earias vitella (Fab.) (Lepidoptera: Noctuidae), to improve the cotton yield in Pakistan

Gene/PromoterPrimers
Primers for full length Cry1Ac geneForward
5’ ATGCATGCGTGAATTGCAGGTAAATGGTTC 3’ Sph1
Reverse
5’ CGGGATCCTTACTATTCCTCCATAAGGAGTAAT 3’ BamH1
Primers for coding region of Cry1Ac gene1Ac Forward
5’ TTTGGGCCCATGGATAACAATCCGA 3’ Apa1
1Ac Reverse
5’ TTTGGGCCCTTCAGCCTCGAGTG 3’ Apa1
Primers for Cry3A promoter regionPro Forward
5’ CGGGATCCGGACTATTATAATCAT 3’ BamH1
Pro Reverse
5’ TTTGGGCCCTTTTCTTCCTCCC3’ Apa1